MirGeneDB

MirGeneDB ID

Gga-Mir-205-P1

Family name MIR-205 (all species)
Seed CCUUCAU
Species Chicken (Gallus gallus)
MiRBase ID gga-mir-205a
Paralogues Gga-Mir-205-P2 
Orthologues Aca-Mir-205-P1  Ami-Mir-205-P1  Bta-Mir-205-P1  Cfa-Mir-205-P1  Cli-Mir-205-P1  Cpi-Mir-205-P1  Cpo-Mir-205-P1  Dno-Mir-205-P1  Dre-Mir-205-P1  Ete-Mir-205-P1  Hsa-Mir-205-P1  Mdo-Mir-205-P1  Mml-Mir-205-P1  Mmu-Mir-205-P1  Oan-Mir-205-P1  Ocu-Mir-205-P1  Rno-Mir-205-P1  Sha-Mir-205-P1  Sto-Mir-205-P1  Tgu-Mir-205-P1a  Tgu-Mir-205-P1b  Xtr-Mir-205-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(galGal5)
26: 3076091-3076149 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGAAAUAAGGACAAUCCAUGGGUUCUGUUGUCCUUCAUUCCACCGGAGUCUGUCUCGUACCUAACCAGAUUUCAGUGGAGUGAAGCACAAGAGACAUGGAGAUGAAUCAGCAAUGAGAG
Get precursor sequence
Structure
        10        20          30        40        50         
AGAAAUAAGGACAAUCCAUGGGU--|  G    C           C        UCUCGU 
                         UCU UUGU CUUCAUUCCAC GGAGUCUG      \
                         AGA AACA GAAGUGAGGUG CUUUAGAC      A
GAGAGUAACGACUAAGUAGAGGUAC^  G    C           A        CAAUCC 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Ad Ad Ad Br Br Ce Ce Ce Ce Ch He He Hy Hy Ki Ki Li Li Lu Lu Ov Pr Pr Sc Sc Sp Sp Te
Mature sequence

Gga-Mir-205-P1_5p

MirBase accessionMIMAT0001184
Sequence
0- UCCUUCAUUCCACCGGAGUCUG -22
Get sequence
Validated targets TargetScanVert: gga-miR-205a
miRDB: MIMAT0001184
Star sequence

Gga-Mir-205-P1_3p*

MirBase accessionNone
Sequence
37- GAUUUCAGUGGAGUGAAGCACA -59
Get sequence