MirGeneDB

MirGeneDB ID

Gga-Mir-19-P2b

Family name MIR-19 (all species)
Seed GUGCAAA
Species Chicken (Gallus gallus)
MiRBase ID gga-mir-19b-2
Paralogues Gga-Mir-19-P1  Gga-Mir-19-P2a 
Orthologues Aca-Mir-19-P2b  Bta-Mir-19-P2b  Cfa-Mir-19-P2b  Cli-Mir-19-P2b  Cpi-Mir-19-P2b  Cpo-Mir-19-P2b  Dno-Mir-19-P2b  Dre-Mir-19-P2b1  Ete-Mir-19-P2b  Hsa-Mir-19-P2b  Mdo-Mir-19-P2b  Mml-Mir-19-P2b  Mmu-Mir-19-P2b  Oan-Mir-19-P2b  Ocu-Mir-19-P2b  Rno-Mir-19-P2b  Sha-Mir-19-P2b  Sto-Mir-19-P2b  Tgu-Mir-19-P2b  Xtr-Mir-19-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(galGal5)
4: 3994717-3994776 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-19-P2b)
Mir-92-P2b 4: 3994429-3994493 [-] UCSC Ensembl
Mir-92-P1b 4: 3994569-3994630 [-] UCSC Ensembl
Mir-19-P2b 4: 3994717-3994776 [-] UCSC Ensembl
Mir-17-P3b 4: 3994853-3994913 [-] UCSC Ensembl
Mir-17-P2b 4: 3995025-3995089 [-] UCSC Ensembl
Mir-17-P1b 4: 3995161-3995218 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AUGCCUUCCGGAGAGGUGCUGCUCACAGUCAGUUUUGCAGGUUUGCAUCCCAGCUUGCUAAAAUUGCUGUGCAAAUCCAUGCAAAACUGACUGUGGUGGUGGUGAAUAGCGGGGUUAGAA
Get precursor sequence
Structure
        10           20        30         40         50          
AUGCCUUCCGGAGAGGU---  UG U                -  -|     UCC    UUGCU 
                    GC  C CACAGUCAGUUUUGCA GG UUUGCA   CAGC     \
                    UG  G GUGUCAGUCAAAACGU CC AAACGU   GUCG     A
AAGAUUGGGGCGAUAAGUGG  GU -                A  U^     ---    UUAAA 
.       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Ad Ad Ad Br Br Ce Ce Ce Ce Ch He He Hy Hy Ki Ki Li Li Lu Lu Ov Pr Pr Sc Sc Sp Sp Te
Star sequence

Gga-Mir-19-P2b_5p*

MirBase accessionNone
Sequence
0- AGUUUUGCAGGUUUGCAUCCCAGC -24
Get sequence
Mature sequence

Gga-Mir-19-P2b_3p

MirBase accessionMIMAT0001110
Sequence
37- UGUGCAAAUCCAUGCAAAACUGA -60
Get sequence