MirGeneDB

MirGeneDB ID

Ete-Mir-23-P1

Family name MIR-23 (all species)
Seed UCACAUU
Species Lesser hedgehog tenrec (Echinops telfairi)
MiRBase ID
Paralogues Ete-Mir-23-P2 
Orthologues Aca-Mir-23-P1  Ami-Mir-23-P1  Bta-Mir-23-P1  Cfa-Mir-23-P1  Cpi-Mir-23-P1  Cpo-Mir-23-P1  Dno-Mir-23-P1  Dre-Mir-23-P1  Hsa-Mir-23-P1  Mdo-Mir-23-P1  Mml-Mir-23-P1  Mmu-Mir-23-P1  Oan-Mir-23-P1  Rno-Mir-23-P1  Sha-Mir-23-P1  Sto-Mir-23-o1  Sto-Mir-23-P1  Xtr-Mir-23-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(echTel2)
JH980397: 3706134-3706191 [+] UCSC
Precursor
(pre-Mir +30nt flank)
CGGUGCCCCCACCCUGUGCCACGGCCGGCGGGGGUUCCUGGGGAUGGGAUUUGCUACCUGUCACAAAUCACAUUGCCAGGGAUUUCCAACCGACCCUGGGCCCUGCCGUCGGGCCACC
Get precursor sequence
Structure
        10         20         30        40        50        
CGGUGCCCCCACCCUGUG-   C  C   C-| GG        G    G     GCUAC 
                   CCA GG CGG  GG  GUUCCUGG GAUG GAUUU     C
                   GGU CC GCC  CC  UAGGGACC UUAC CUAAA     U
CCACCGGGCUGCCGUCCCG   C  A   AA^ UU        G    A     CACUG 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
To
Star sequence

Ete-Mir-23-P1_5p*

MirBase accessionNone
Sequence
0- GGGGUUCCUGGGGAUGGGAUUU -22
Get sequence
Mature sequence

Ete-Mir-23-P1_3p

MirBase accessionNone
Sequence
36- AUCACAUUGCCAGGGAUUUCCA -58
Get sequence