MirGeneDB

MirGeneDB ID

Ete-Mir-219-P1

Family name MIR-219 (all species)
Seed GAUUGUC
Species Lesser hedgehog tenrec (Echinops telfairi)
MiRBase ID
Paralogues Ete-Mir-219-P2 
Orthologues Aae-Mir-219  Aca-Mir-219-P1  Ami-Mir-219-P1  Bfl-Mir-219  Bge-Mir-219  Bta-Mir-219-P1  Cfa-Mir-219-P1  Cgi-Mir-219  Cin-Mir-219  Cpi-Mir-219-P1  Cpo-Mir-219-P1  Cte-Mir-219  Dan-Mir-219  Dme-Mir-219  Dmo-Mir-219  Dno-Mir-219-P1  Dpu-Mir-219  Dre-Mir-219-P1a  Hsa-Mir-219-P1  Isc-Mir-219  Lan-Mir-219  Mdo-Mir-219-P1  Mml-Mir-219-P1  Mmu-Mir-219-P1  Mmu-Mir-219-P1-as  Ocu-Mir-219-P1  Pfl-Mir-219  Pmi-Mir-219  Rno-Mir-219-P1  Sha-Mir-219-P1  Sko-Mir-219  Spu-Mir-219  Sto-Mir-219-P1-v1  Sto-Mir-219-P1-v2  Tca-Mir-219 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(echTel2)
JH980348: 13433336-13433399 [+] UCSC
Precursor
(pre-Mir +30nt flank)
GCCUCCUUCCCCGCCCCGGGCUGCGGCUCUUGAUUGUCCAAACGCAAUUCUCGAGUCUUUGGCUCUGGCCGAGAGUUGCGUCUGGACGUCCCGAGCCGCCGCCCCCAGACCUCGAGGGGAGAGC
Get precursor sequence
Structure
        10           20        30        40        50        60 
GCCUCCUUCCCCGCCCC---|   U       UU   U     A            AGUCUUU 
                    GGGC GCGGCUC  GAU GUCCA ACGCAAUUCUCG       G
                    CCCG CGCCGAG  CUG CAGGU UGCGUUGAGAGC       G
CGAGAGGGGAGCUCCAGACC^   C       CC   -     C            CGGUCUC 
  120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Ete-Mir-219-P1_5p

MirBase accessionNone
Sequence
0- UGAUUGUCCAAACGCAAUUCUCG -23
Get sequence
Star sequence

Ete-Mir-219-P1_3p* (predicted)

MirBase accessionNone
Sequence
41- AGAGUUGCGUCUGGACGUCCCGA -64
Get sequence