MirGeneDB

MirGeneDB ID

Ete-Mir-205-P1

Family name MIR-205 (all species)
Seed CCUUCAU
Species Lesser hedgehog tenrec (Echinops telfairi)
MiRBase ID
Paralogues
Orthologues Aca-Mir-205-P1  Ami-Mir-205-P1  Bta-Mir-205-P1  Cfa-Mir-205-P1  Cli-Mir-205-P1  Cpi-Mir-205-P1  Cpo-Mir-205-P1  Dno-Mir-205-P1  Dre-Mir-205-P1  Gga-Mir-205-P1  Hsa-Mir-205-P1  Mdo-Mir-205-P1  Mml-Mir-205-P1  Mmu-Mir-205-P1  Oan-Mir-205-P1  Ocu-Mir-205-P1  Rno-Mir-205-P1  Sha-Mir-205-P1  Sto-Mir-205-P1  Tgu-Mir-205-P1a  Tgu-Mir-205-P1b  Xtr-Mir-205-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(echTel2)
JH980299: 36621478-36621536 [+] UCSC
Precursor
(pre-Mir +30nt flank)
GGUCCCAAGACAAUCCAUGAAUUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUUAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCAGACGCCGCGCCCGCCG
Get precursor sequence
Structure
        10        20          30        40        50         
GGUCCCAAGACAAUCCAUGAAUU--|      UC           C        UCUUAU 
                         UCUCUUG  CUUCAUUCCAC GGAGUCUG      \
                         GGAGGAC  GAAGUGAGGUG CUUUAGAC      A
GCCGCCCGCGCCGCAGACGAGGUAC^      UU           A        CAACCC 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Ete-Mir-205-P1_5p

MirBase accessionNone
Sequence
0- UCCUUCAUUCCACCGGAGUCUG -22
Get sequence
Star sequence

Ete-Mir-205-P1_3p*

MirBase accessionNone
Sequence
37- GAUUUCAGUGGAGUGAAGUUCA -59
Get sequence