MirGeneDB

MirGeneDB ID

Ete-Mir-19-P2b

Family name MIR-19 (all species)
Seed GUGCAAA
Species Lesser hedgehog tenrec (Echinops telfairi)
MiRBase ID
Paralogues Ete-Mir-19-P1  Ete-Mir-19-P2a 
Orthologues Aca-Mir-19-P2b  Bta-Mir-19-P2b  Cfa-Mir-19-P2b  Cli-Mir-19-P2b  Cpi-Mir-19-P2b  Cpo-Mir-19-P2b  Dno-Mir-19-P2b  Dre-Mir-19-P2b1  Gga-Mir-19-P2b  Hsa-Mir-19-P2b  Mdo-Mir-19-P2b  Mml-Mir-19-P2b  Mmu-Mir-19-P2b  Oan-Mir-19-P2b  Ocu-Mir-19-P2b  Rno-Mir-19-P2b  Sha-Mir-19-P2b  Sto-Mir-19-P2b  Tgu-Mir-19-P2b  Xtr-Mir-19-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(echTel2)
JH980394: 1010568-1010631 [+] UCSC
Precursor
(pre-Mir +30nt flank)
GCCAUCUCCAAGAUACUGCUGUUUACGGUGAGUUUUGCAGGUUUGCAUUUCAGCAUGUAUGUAUCUAUGGCUGUGCAAAUCCAUGCAAAACUGAUUGUGAGCGGUGGGAGCUGUCUGCACUUUC
Get precursor sequence
Structure
        10          20        30         40         50        60  
GCCAUCUCCAAGAUACU--            G         -  -|     UUU    AUGUAUG 
                   GCUGUUUACGGU AGUUUUGCA GG UUUGCA   CAGC       \
                   UGGCGAGUGUUA UCAAAACGU CC AAACGU   GUCG       U
CUUUCACGUCUGUCGAGGG            G         A  U^     ---    GUAUCUA 
  120       110       100        90        80           70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
To
Star sequence

Ete-Mir-19-P2b_5p* (predicted)

MirBase accessionNone
Sequence
0- AGUUUUGCAGGUUUGCAUUUCAGC -24
Get sequence
Mature sequence

Ete-Mir-19-P2b_3p

MirBase accessionNone
Sequence
41- UGUGCAAAUCCAUGCAAAACUGA -64
Get sequence