MirGeneDB

MirGeneDB ID

Efe-Mir-9-P16

Family name MIR-9 (all species)
Seed CUUUGGU
Species Common brandling worm (Eisenia fetida)
MiRBase ID
Paralogues Efe-Mir-9-P15 
Orthologues Cin-Mir-9  Cte-Mir-9  Dpu-Mir-9-o16  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Pmi-Mir-9  Spu-Mir-9 
Node of Origin (locus) E. fetida
Node of Origin (family) Bilateria
Genome context
(Efe_combined)
Efet.01.1380669: 63-123 [-]
Precursor
(pre-Mir +30nt flank)
NNNNNUGAUGUUGAUGAGAUUUUCUGACUGUCUUUGGUUAUCUAGCUGUAUGAUUGGUUCGAUACGUCAUAAAGCUAGGUUACCGAAGCAAAACGGAAAACGGUUUGCAACUGAUGCGCUG
Get precursor sequence
Structure
        10          20         30        40        50          
NNNNNUGAUGUUGAUGAGA--       AC-| U       U        G     UUGGUU 
                     UUUUCUG   UG CUUUGGU AUCUAGCU UAUGA      \
                     AAAAGGC   AC GAAGCCA UGGAUCGA AUACU      C
GUCGCGUAGUCAACGUUUGGC       AAA^ -       U        A     GCAUAG 
 .       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Efe-Mir-9-P16_5p

MirBase accessionNone
Sequence
0- UCUUUGGUUAUCUAGCUGUAUGA -23
Get sequence
Star sequence

Efe-Mir-9-P16_3p* (predicted)

MirBase accessionNone
Sequence
38- AUAAAGCUAGGUUACCGAAGCAA -61
Get sequence