MirGeneDB

MirGeneDB ID

Efe-Mir-9-P15

Family name MIR-9 (all species)
Seed CUUUGGU
Species Common brandling worm (Eisenia fetida)
MiRBase ID
Paralogues Efe-Mir-9-P16 
Orthologues Cin-Mir-9  Cte-Mir-9  Dpu-Mir-9-o15  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Pmi-Mir-9  Spu-Mir-9 
Node of Origin (locus) E. fetida
Node of Origin (family) Bilateria
Genome context
(Efe_combined)
Efet.01.650086: 1540-1600 [+]
Precursor
(pre-Mir +30nt flank)
UCUGAGCUUCUACGGCGAGCGUGAUAUUUGUCUUUGGUUAUCAAGCUGUAUGAUUGAUUUGAAAUUUCAUAAAGCUAGGUUACCAAAGCUAAAACGAACGCCUAGCAACAGCAGCCGAUCA
Get precursor sequence
Structure
        10          20        30        40        50          
UCUGAGCUUCUACGGCGA--|   GAUA    U       U   A    G     UUGAUU 
                    GCGU    UUUG CUUUGGU AUC AGCU UAUGA      \
                    CGCA    AAAU GAAACCA UGG UCGA AUACU      U
ACUAGCCGACGACAACGAUC^   AGCA    C       U   A    A     UUAAAG 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Efe-Mir-9-P15_5p

MirBase accessionNone
Sequence
0- UCUUUGGUUAUCAAGCUGUAUGA -23
Get sequence
Star sequence

Efe-Mir-9-P15_3p*

MirBase accessionNone
Sequence
38- AUAAAGCUAGGUUACCAAAGCUA -61
Get sequence