MirGeneDB

MirGeneDB ID

Efe-Mir-219-P5

Family name MIR-219 (all species)
Seed GAUUGUC
Species Common brandling worm (Eisenia fetida)
MiRBase ID
Paralogues Efe-Mir-219-P3  Efe-Mir-219-P4 
Orthologues Aae-Mir-219  Bfl-Mir-219  Bge-Mir-219  Cgi-Mir-219  Cin-Mir-219  Cte-Mir-219  Dan-Mir-219  Dme-Mir-219  Dmo-Mir-219  Dpu-Mir-219  Isc-Mir-219  Lan-Mir-219  Pfl-Mir-219  Pmi-Mir-219  Sko-Mir-219  Spu-Mir-219  Tca-Mir-219 
Node of Origin (locus) E. fetida
Node of Origin (family) Bilateria
Genome context
(Efe_combined)
Efet.01.56519: 3866-3931 [-]
Precursor
(pre-Mir +30nt flank)
CCGAUGUUAUAUGAUGAUGUUCUGAGGUGCUGAUUGUCCGAGCGCAGUUCUUCAGUGGUCGUUGCGAUAUUCAAGAAAUGCAAUUUGGACAUCAGCACACUGCAACAGAGUAACAUCAGCACAACA
Get precursor sequence
Structure
        10          20         30        40         50        60  
CCGAUGUUAUAUGAUGA--|   CUG  -        U       C-   G     CAGUGGUCG 
                   UGUU   AG GUGCUGAU GUCCGAG  GCA UUCUU         U
                   ACAA   UC CACGACUA CAGGUUU  CGU AAGAA         U
ACAACACGACUACAAUGAG^   CG-  A        -       AA   A     CUUAUAGCG 
    120       110        100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Efe-Mir-219-P5_5p

MirBase accessionNone
Sequence
0- UGAUUGUCCGAGCGCAGUUCUU -22
Get sequence
Star sequence

Efe-Mir-219-P5_3p*

MirBase accessionNone
Sequence
44- GAAAUGCAAUUUGGACAUCAGC -66
Get sequence