MirGeneDB

MirGeneDB ID

Efe-Mir-219-P4

Family name MIR-219 (all species)
Seed GAUUGUC
Species Common brandling worm (Eisenia fetida)
MiRBase ID
Paralogues Efe-Mir-219-P3  Efe-Mir-219-P5 
Orthologues Aae-Mir-219  Bfl-Mir-219  Bge-Mir-219  Cgi-Mir-219  Cin-Mir-219  Cte-Mir-219  Dan-Mir-219  Dme-Mir-219  Dmo-Mir-219  Dpu-Mir-219  Isc-Mir-219  Lan-Mir-219  Pfl-Mir-219  Pmi-Mir-219  Sko-Mir-219  Spu-Mir-219  Tca-Mir-219 
Node of Origin (locus) E. fetida
Node of Origin (family) Bilateria
Genome context
(Efe_combined)
Efet.01.135199: 2555-2617 [+]
Precursor
(pre-Mir +30nt flank)
AUUGGCCAGUCGUGAACACGGUUCUGGCGCUGAUUGUCCAAACGCAGUUCUUGUUCUCAUGUUUGUCGUCAAGAACUGUGUGUGGACGUCAGUGGCUUUACGUUCGCUCUACAUUCGCCAGAU
Get precursor sequence
Structure
        10           20         30        40        50        60 
AUUGGCCAGUCGUGAAC---|  GUUCU   -      U     A            UUCUCAU 
                    ACG     GGC GCUGAU GUCCA ACGCAGUUCUUG       G
                    UGC     UCG UGACUG CAGGU UGUGUCAAGAAC       U
UAGACCGCUUACAUCUCGCU^  AUU--   G      -     G            UGCUGUU 
 120       110       100          90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Efe-Mir-219-P4_5p

MirBase accessionNone
Sequence
0- UGAUUGUCCAAACGCAGUUCUUG -23
Get sequence
Star sequence

Efe-Mir-219-P4_3p*

MirBase accessionNone
Sequence
41- AGAACUGUGUGUGGACGUCAGU -63
Get sequence