MirGeneDB

MirGeneDB ID

Efe-Mir-219-P3

Family name MIR-219 (all species)
Seed GAUUGUC
Species Common brandling worm (Eisenia fetida)
MiRBase ID
Paralogues Efe-Mir-219-P4  Efe-Mir-219-P5 
Orthologues Aae-Mir-219  Bfl-Mir-219  Bge-Mir-219  Cgi-Mir-219  Cin-Mir-219  Cte-Mir-219  Dan-Mir-219  Dme-Mir-219  Dmo-Mir-219  Dpu-Mir-219  Isc-Mir-219  Lan-Mir-219  Pfl-Mir-219  Pmi-Mir-219  Sko-Mir-219  Spu-Mir-219  Tca-Mir-219 
Node of Origin (locus) E. fetida
Node of Origin (family) Bilateria
Genome context
(Efe_combined)
Efet.01.125734: 1344-1402 [-]
Precursor
(pre-Mir +30nt flank)
GCCAGAAUGACCUUCGCAUUAAUCUGACUCUGAUUGUCCAUUCGCAGUUCUUGUUCGCGUUCUUCCAAGAACUGUGCGUGGACGUCAGUGUCCGAUUAGUGGACUUCCGGUCCGCAGCA
Get precursor sequence
Structure
        10          20        30        40        50         
GCCAGAAUGACCUUCGC--|      U   U     U      U           UUCGC 
                   AUUAAUC GAC CUGAU GUCCAU CGCAGUUCUUG     G
                   UGAUUAG CUG GACUG CAGGUG GUGUCAAGAAC     U
ACGACGCCUGGCCUUCAGG^      C   U     -      C           CUUCU 
       110       100        90         80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Mature sequence

Efe-Mir-219-P3_5p

MirBase accessionNone
Sequence
0- UGAUUGUCCAUUCGCAGUUCUUG -23
Get sequence
Star sequence

Efe-Mir-219-P3_3p*

MirBase accessionNone
Sequence
37- AGAACUGUGCGUGGACGUCAGU -59
Get sequence