MirGeneDB

MirGeneDB ID

Efe-Mir-124-P9

Family name MIR-124 (all species)
Seed AAGGCAC
Species Common brandling worm (Eisenia fetida)
MiRBase ID
Paralogues Efe-Mir-124-P5  Efe-Mir-124-P6  Efe-Mir-124-P7  Efe-Mir-124-P8 
Orthologues Aae-Mir-124  Asu-Mir-124  Bfl-Mir-124  Bge-Mir-124  Cel-Mir-124  Cte-Mir-124  Dan-Mir-124  Dme-Mir-124  Dmo-Mir-124  Dpu-Mir-124  Hme-Mir-124  Isc-Mir-124  Lan-Mir-124  Pfl-Mir-124  Pmi-Mir-124  Sko-Mir-124  Spu-Mir-124  Tca-Mir-124 
Node of Origin (locus) E. fetida
Node of Origin (family) Bilateria
Genome context
(Efe_combined)
Efet.01.62080: 4979-5039 [+]
Precursor
(pre-Mir +30nt flank)
GCCGAUGUUGACUUAGCGGCUACGGCUGUUGGCAUAGACCGCGUCGGCCUUAGUGUCAAGCGGAACAAUUAAGGCACGCGGUGAAUGCCGACAGAAUAGCCAGUCCAUCAUCUGUGAAGAG
Get precursor sequence
Structure
        10           20        30        40        50        60 
GCCGAUGUUGACUUAGC---|    CGG          AG       CG        GUCAAG 
                    GGCUA   CUGUUGGCAU  ACCGCGU  GCCUUAGU      \
                    CCGAU   GACAGCCGUA  UGGCGCA  CGGAAUUA      C
GAGAAGUGUCUACUACCUGA^    AA-          AG       --        ACAAGG 
 .       110       100         90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Efe-Mir-124-P9_5p* (predicted)

MirBase accessionNone
Sequence
0- GGCAUAGACCGCGUCGGCCUUAGU -24
Get sequence
Mature sequence

Efe-Mir-124-P9_3p

MirBase accessionNone
Sequence
39- UAAGGCACGCGGUGAAUGCCGA -61
Get sequence