MirGeneDB

MirGeneDB ID

Efe-Mir-124-P8

Family name MIR-124 (all species)
Seed AAGGCAC
Species Common brandling worm (Eisenia fetida)
MiRBase ID
Paralogues Efe-Mir-124-P5  Efe-Mir-124-P6  Efe-Mir-124-P7  Efe-Mir-124-P9 
Orthologues Aae-Mir-124  Asu-Mir-124  Bfl-Mir-124  Bge-Mir-124  Cel-Mir-124  Cte-Mir-124  Dan-Mir-124  Dme-Mir-124  Dmo-Mir-124  Dpu-Mir-124  Hme-Mir-124  Isc-Mir-124  Lan-Mir-124  Pfl-Mir-124  Pmi-Mir-124  Sko-Mir-124  Spu-Mir-124  Tca-Mir-124 
Node of Origin (locus) E. fetida
Node of Origin (family) Bilateria
Genome context
(Efe_combined)
Efet.01.599499: 601-662 [+]
Precursor
(pre-Mir +30nt flank)
GCCGUCUGAUUUGGAGAUAUAGUUGUACUUAGUGUUCACUGCGGAUGCUUUAGUGUUUCUUUUGACGAAUUAAGGCACGCGGUGAAUGCUACGAACAACAGCUACGACUACAAGACUACGAA
Get precursor sequence
Structure
        10        20          30        40        50        60 
GCCGUCUGAUUUGGAGAUAUA--|    ACU              GA         GUUUCU 
                       GUUGU   UAGUGUUCACUGCG  UGCUUUAGU      U
                       CAACA   AUCGUAAGUGGCGC  ACGGAAUUA      U
AAGCAUCAGAACAUCAGCAUCGA^    AGC              --         AGCAGU 
120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Efe-Mir-124-P8_5p* (predicted)

MirBase accessionNone
Sequence
0- AGUGUUCACUGCGGAUGCUUUAGU -24
Get sequence
Mature sequence

Efe-Mir-124-P8_3p

MirBase accessionNone
Sequence
40- UAAGGCACGCGGUGAAUGCUAC -62
Get sequence