MirGeneDB

MirGeneDB ID

Efe-Mir-124-P6

Family name MIR-124 (all species)
Seed AAGGCAC
Species Common brandling worm (Eisenia fetida)
MiRBase ID
Paralogues Efe-Mir-124-P5  Efe-Mir-124-P7  Efe-Mir-124-P8  Efe-Mir-124-P9 
Orthologues Aae-Mir-124  Asu-Mir-124  Bfl-Mir-124  Bge-Mir-124  Cel-Mir-124  Cte-Mir-124  Dan-Mir-124  Dme-Mir-124  Dmo-Mir-124  Dpu-Mir-124  Hme-Mir-124  Isc-Mir-124  Lan-Mir-124  Pfl-Mir-124  Pmi-Mir-124  Sko-Mir-124  Spu-Mir-124  Tca-Mir-124 
Node of Origin (locus) E. fetida
Node of Origin (family) Bilateria
Genome context
(Efe_combined)
Efet.01.61867: 2146-2211 [-]
Precursor
(pre-Mir +30nt flank)
CUUCCAGCAACGAUUAUUUGUCCACCUGUCGACGUUCACUGCGCUUGCCUUGAUGUGCCGCUUCUGGUAGAAAUUAAGGCACGCGGUGAAUGCCAACAUGUGAAUGCCGAUACGUGAAAGCGACAU
Get precursor sequence
Structure
        10        20          30        40        50        60   
CUUCCAGCAACGAUUAUUUGUC--|  C   CGA           CU         GUGCCGCU 
                        CAC UGU   CGUUCACUGCG  UGCCUUGAU        U
                        GUG ACA   GUAAGUGGCGC  ACGGAAUUA        C
UACAGCGAAAGUGCAUAGCCGUAA^  U   ACC           --         AAGAUGGU 
    120       110       100        90          80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
To
Star sequence

Efe-Mir-124-P6_5p* (predicted)

MirBase accessionNone
Sequence
0- GACGUUCACUGCGCUUGCCUUGAU -24
Get sequence
Mature sequence

Efe-Mir-124-P6_3p

MirBase accessionNone
Sequence
44- UAAGGCACGCGGUGAAUGCCAA -66
Get sequence