MirGeneDB

MirGeneDB ID

Efe-Mir-124-P5

Family name MIR-124 (all species)
Seed AAGGCAC
Species Common brandling worm (Eisenia fetida)
MiRBase ID
Paralogues Efe-Mir-124-P6  Efe-Mir-124-P7  Efe-Mir-124-P8  Efe-Mir-124-P9 
Orthologues Aae-Mir-124  Asu-Mir-124  Bfl-Mir-124  Bge-Mir-124  Cel-Mir-124  Cte-Mir-124  Dan-Mir-124  Dme-Mir-124  Dmo-Mir-124  Dpu-Mir-124  Hme-Mir-124  Isc-Mir-124  Lan-Mir-124  Pfl-Mir-124  Pmi-Mir-124  Sko-Mir-124  Spu-Mir-124  Tca-Mir-124 
Node of Origin (locus) E. fetida
Node of Origin (family) Bilateria
Genome context
(Efe_combined)
Efet.01.191600: 2530-2596 [+]
Precursor
(pre-Mir +30nt flank)
UGCGGACUGGCGCUGCUGCUGCUGCCUCUGCGUGUUCACCGGACUUGCCUUGAUGUGGCGAUAUGAUGAAACGAUUAAGGCACGCGGUGAAUGCCAAGGGUCGGCGGGUGGCCUCCUACAUGGACAA
Get precursor sequence
Structure
        10          20         30        40        50        60    
UGCGGACUGGCGCUGCUG--      -| UC  C          GACU         GUGGCGAUA 
                    CUGCUG CC  UG GUGUUCACCG    UGCCUUGAU         \
                    GGCGGC GG  AC CGUAAGUGGC    ACGGAAUUA         U
AACAGGUACAUCCUCCGGUG      U^ GA  -          GC--         GCAAAGUAG 
     120       110       100         90          80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Star sequence

Efe-Mir-124-P5_5p*

MirBase accessionNone
Sequence
0- CGUGUUCACCGGACUUGCCUUGAU -24
Get sequence
Mature sequence

Efe-Mir-124-P5_3p

MirBase accessionNone
Sequence
45- UAAGGCACGCGGUGAAUGCCAA -67
Get sequence