MirGeneDB

MirGeneDB ID

Dre-Mir-9-P3b

Family name MIR-9 (all species)
Seed CUUUGGU
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-9-3
Paralogues Dre-Mir-9-P1  Dre-Mir-9-P2a  Dre-Mir-9-P2b  Dre-Mir-9-P3a  Dre-Mir-9-P4a  Dre-Mir-9-P4b 
Orthologues Aca-Mir-9-P3  Ami-Mir-9-P3  Bta-Mir-9-P3  Cfa-Mir-9-P3  Cin-Mir-9  Cpi-Mir-9-P3  Cpo-Mir-9-P3  Cte-Mir-9  Dno-Mir-9-P3  Ete-Mir-9-P3  Gga-Mir-9-P3  Hsa-Mir-9-P3  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Mdo-Mir-9-P3  Mml-Mir-9-P3  Mmu-Mir-9-P3  Oan-Mir-9-P3  Ocu-Mir-9-P3  Pmi-Mir-9  Rno-Mir-9-P3  Sha-Mir-9-P3  Spu-Mir-9  Sto-Mir-9-P3  Tgu-Mir-9-P3  Xtr-Mir-9-P3 
Node of Origin (locus) D. rerio
Node of Origin (family) Bilateria
Genome context
(danRer11)
chr25: 8551263-8551322 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UAAUCAUCUCUUUCAGGGGGUUGGUUUCUCUCUUUGGUUAUCUAGCUGUAUGAGUUAUAACACUGUCAUAAAGCUAGAUAACCGAAAGUAGAAAUAAUUCCCAAAAUCUUUGGAAGACAG
Get precursor sequence
Structure
        10         20          30        40        50         
UAAUCAUCUCUUUCAGG-   UUG-      -| C               G     GUUAU 
                  GGG    GUUUCU CU UUUGGUUAUCUAGCU UAUGA     A
                  CCC    UAAAGA GA AAGCCAAUAGAUCGA AUACU     A
GACAGAAGGUUUCUAAAA   UUAA      U^ -               A     GUCAC 
.       110       100        90         80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Mature sequence

Dre-Mir-9-P3b_5p

MirBase accessionMIMAT0001769
Sequence
0- UCUUUGGUUAUCUAGCUGUAUGA -23
Get sequence
Validated targets TargetScanFish: dre-miR-9
Star sequence

Dre-Mir-9-P3b_3p*

MirBase accessionMIMAT0003156
Sequence
37- AUAAAGCUAGAUAACCGAAAGUA -60
Get sequence