MirGeneDB

MirGeneDB ID

Dre-Mir-728

Family name MIR-728 (all species)
Seed UACUAAG
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-728
Paralogues
Orthologues
Node of Origin (locus) D. rerio
Node of Origin (family) D. rerio
Genome context
(danRer11)
chr24: 26190564-26190624 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-728)
Mir-727-v1 chr24: 26185423-26185488 [+] UCSC Ensembl
Mir-727-v2 chr24: 26185425-26185487 [+] UCSC Ensembl
Mir-728 chr24: 26190564-26190624 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GUGGUUUGGAGUGUUUGGCAUCUUCUGAGGAAAUGUAGUAGACUAUAAGUAUACAGUGAACAUGAACGUAUACUAAGUACACUACGUUUUCUCAAGAGGUGGAAUCUCACCGCGUGUUUUG
Get precursor sequence
Structure
        10          20        30        40        50        60 
GUGGUUUGGAGUGUUUGG--|    UC              AG   AUA       AGUGAA 
                    CAUCU  UGAGGAAAUGUAGU  ACU   AGUAUAC      \
                    GUGGA  ACUCUUUUGCAUCA  UGA   UCAUAUG      C
GUUUUGUGCGCCACUCUAAG^    GA              CA   A--       CAAGUA 
 .       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-728_5p*

MirBase accessionNone
Sequence
0- AAAUGUAGUAGACUAUAAGUAUAC -24
Get sequence
Mature sequence

Dre-Mir-728_3p

MirBase accessionMIMAT0003757
Sequence
39- AUACUAAGUACACUACGUUUUC -61
Get sequence
Validated targets TargetScanFish: dre-miR-728