MirGeneDB

MirGeneDB ID

Dre-Mir-455-P2

Family name MIR-455 (all species)
Seed AUGUGCC
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-455-2
Paralogues Dre-Mir-455-P1 
Orthologues Aca-Mir-455  Ami-Mir-455  Bta-Mir-455  Cfa-Mir-455  Cli-Mir-455  Cpi-Mir-455  Cpo-Mir-455  Dno-Mir-455  Ete-Mir-455  Gga-Mir-455  Hsa-Mir-455  Mdo-Mir-455  Mml-Mir-455  Mmu-Mir-455  Oan-Mir-455  Ocu-Mir-455  Rno-Mir-455  Sha-Mir-455  Sto-Mir-455  Tgu-Mir-455  Xtr-Mir-455 
Node of Origin (locus) D. rerio
Node of Origin (family) Vertebrata
Genome context
(danRer11)
chr16: 51776559-51776617 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGUUUCCAUCGUUGUUCCCUGAAGUGAGGGUAUGUGCCCUUGGACUACAUUGUGGAGGCCAGCACCAUGCAGUCCAUGGGCAUAUACACUUACUUCAUGGCCUACAUCAACACGAAGAC
Get precursor sequence
Structure
        10           20        30        40        50        
UGUUUCCAUCGUUGUUC--  -|        G          U      A   U UGGAG 
                   CC UGAAGUGAG GUAUGUGCCC UGGACU CAU G     G
                   GG ACUUCAUUC CAUAUACGGG ACCUGA GUA C     C
CAGAAGCACAACUACAUCC  U^        A          U      C   C ACGAC 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
CommentThere are mutliple Dicer cuts on the 3p arm relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Mature sequence

Dre-Mir-455-P2_5p

MirBase accessionMIMAT0011302
Sequence
0- UAUGUGCCCUUGGACUACAUUG -22
Get sequence
Validated targets TargetScanFish: dre-miR-455b
Star sequence

Dre-Mir-455-P2_3p*

MirBase accessionMIMAT0031993
Sequence
36- AUGCAGUCCAUGGGCAUAUACAC -59
Get sequence