MirGeneDB

MirGeneDB ID

Dre-Mir-29-P1a

Family name MIR-29 (all species)
Seed AGCACCA
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-29a
Paralogues Dre-Mir-29-P2a  Dre-Mir-29-P2b1  Dre-Mir-29-P2b2 
Orthologues Aca-Mir-29-P1a  Ami-Mir-29-P1a  Asu-Mir-29-P1  Bfl-Mir-29-P1  Bta-Mir-29-P1a  Cbr-Mir-29-P1  Cel-Mir-29-P1  Cfa-Mir-29-P1a  Cgi-Mir-29-P1  Cin-Mir-29-P1  Cli-Mir-29-P1a  Cpi-Mir-29-P1a  Cpo-Mir-29-P1a  Cte-Mir-29-P1  Dno-Mir-29-P1a  Ete-Mir-29-P1a  Gga-Mir-29-P1a  Hsa-Mir-29-P1a  Isc-Mir-29-P1  Lgi-Mir-29-P1  Mdo-Mir-29-P1a  Mml-Mir-29-P1a  Mmu-Mir-29-P1a  Oan-Mir-29-P1a  Ocu-Mir-29-P1a  Pfl-Mir-29-P1  Pmi-Mir-29-P1  Rno-Mir-29-P1a  Sha-Mir-29-P1a  Sko-Mir-29-P1  Spu-Mir-29-P1  Sto-Mir-29-P1a  Tgu-Mir-29-P1a  Xtr-Mir-29-P1a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(danRer11)
chr4: 11606782-11606841 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-29-P1a)
Mir-29-P1a chr4: 11606782-11606841 [-] UCSC Ensembl
Mir-29-P2a chr4: 11608208-11608269 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCUCUCUCUCUCUCUCCCCACCAAACGAUGACUGAUUUCCUUUGGUGCUUAGAGUCCCAUCUGUCAUCUAGCACCAUUUGAAAUCGGUUAUAAUGACUGGGGAUCAAUUCUUCAGCUUCU
Get precursor sequence
Structure
        10         20          30        40        50          
UCUCUCUCUCUCUCUCC-  A   AACG--|           CUU       U   GUCCCA 
                  CC CCA      AUGACUGAUUUC   UGGUGCU AGA      \
                  GG GGU      UAUUGGCUAAAG   ACCACGA UCU      U
UCUUCGACUUCUUAACUA  -   CAGUAA^           UUU       -   ACUGUC 
.       110        100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-29-P1a_5p*

MirBase accessionNone
Sequence
0- ACUGAUUUCCUUUGGUGCUUAGA -23
Get sequence
Mature sequence

Dre-Mir-29-P1a_3p

MirBase accessionMIMAT0001802
Sequence
38- UAGCACCAUUUGAAAUCGGUUA -60
Get sequence
Validated targets TargetScanFish: dre-miR-29a