MirGeneDB

MirGeneDB ID

Dre-Mir-24-P4

Family name MIR-24 (all species)
Seed GCCUACU
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-24b
Paralogues Dre-Mir-24-P1  Dre-Mir-24-P2a  Dre-Mir-24-P2b  Dre-Mir-24-P3 
Orthologues
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(danRer11)
chr2: 33905776-33905833 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-24-P4)
Mir-23-P4 chr2: 33900445-33900503 [+] UCSC Ensembl
Mir-27-P4 chr2: 33902361-33902423 [+] UCSC Ensembl
Mir-24-P4 chr2: 33905776-33905833 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GUGAGGUUCAGCACUGGGUUCAACCUCCUGUGCCUACUGAGCUGAUAACAGUUGAUGUAUUUAGCACUGGCUCAGUUCAGCAGGAACCGGAGUUAAGCCCCUUAAGACCAAGGGCGCU
Get precursor sequence
Structure
        10           20        30        40        50         
GUGAGGUUCAGCACUGG---|  C   C   U  G   A         UAA    UGAUGU 
                    GUU AAC UCC GU CCU CUGAGCUGA   CAGU      \
                    CGA UUG AGG CA GGA GACUUGACU   GUCA      A
UCGCGGGAACCAGAAUUCCC^  A   -   C  A   C         CG-    CGAUUU 
      110       100         90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Mature sequence

Dre-Mir-24-P4_5p

MirBase accessionMIMAT0048662
Sequence
0- UGCCUACUGAGCUGAUAACAGU -22
Get sequence
Co-mature sequence

Dre-Mir-24-P4_3p

MirBase accessionMIMAT0048663
Sequence
37- UGGCUCAGUUCAGCAGGAACC -58
Get sequence