MirGeneDB

MirGeneDB ID

Dre-Mir-23-P4

Family name MIR-23 (all species)
Seed UCACAUU
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-23a-3
Paralogues Dre-Mir-23-P1  Dre-Mir-23-P2a  Dre-Mir-23-P2b  Dre-Mir-23-P3 
Orthologues
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(danRer11)
chr2: 33900445-33900503 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-23-P4)
Mir-23-P4 chr2: 33900445-33900503 [+] UCSC Ensembl
Mir-27-P4 chr2: 33902361-33902423 [+] UCSC Ensembl
Mir-24-P4 chr2: 33905776-33905833 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AUGGUCAUCUCAUCAAUGGACCAGCUGGAGGGAUUCCUGGCAGAGUGAUUUGGGAUUAUAUCAUAAAAUCACAUUGCCAGGGAUUUCCAACCAGCUGUGAACUGUUUACUCCAGGAAAG
Get precursor sequence
Structure
        10        20           30        40        50        
AUGGUCAUCUCAUCAAUGGAC-       A--|GG           A       GGGAUU 
                      CAGCUGG   G  AUUCCUGGCAG GUGAUUU      A
                      GUCGACC   C  UAGGGACCGUU CACUAAA      U
GAAAGGACCUCAUUUGUCAAGU       AAC^UU           A       AUACUA 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-23-P4_5p*

MirBase accessionMIMAT0031945
Sequence
0- GGAUUCCUGGCAGAGUGAUUU -21
Get sequence
Mature sequence

Dre-Mir-23-P4_3p

MirBase accessionMIMAT0001790
Sequence
37- AUCACAUUGCCAGGGAUUUCCA -59
Get sequence
Validated targets TargetScanFish: dre-miR-23a