MirGeneDB

MirGeneDB ID

Dre-Mir-219-P1a

Family name MIR-219 (all species)
Seed GAUUGUC
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-219-3
Paralogues Dre-Mir-219-P2a  Dre-Mir-219-P2b 
Orthologues Aae-Mir-219  Aca-Mir-219-P1  Ami-Mir-219-P1  Bfl-Mir-219  Bge-Mir-219  Bta-Mir-219-P1  Cfa-Mir-219-P1  Cgi-Mir-219  Cin-Mir-219  Cpi-Mir-219-P1  Cpo-Mir-219-P1  Cte-Mir-219  Dan-Mir-219  Dme-Mir-219  Dmo-Mir-219  Dno-Mir-219-P1  Dpu-Mir-219  Ete-Mir-219-P1  Hsa-Mir-219-P1  Isc-Mir-219  Lan-Mir-219  Mdo-Mir-219-P1  Mml-Mir-219-P1  Mmu-Mir-219-P1  Mmu-Mir-219-P1-as  Ocu-Mir-219-P1  Pfl-Mir-219  Pmi-Mir-219  Rno-Mir-219-P1  Sha-Mir-219-P1  Sko-Mir-219  Spu-Mir-219  Sto-Mir-219-P1-v1  Sto-Mir-219-P1-v2  Tca-Mir-219 
Node of Origin (locus) D. rerio
Node of Origin (family) Bilateria
Genome context
(danRer11)
chr19: 18861780-18861840 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUGUCUGGUUUGAUACUGACGGUCAGGUGCUGAUUGUCCAAACGCAAUUCUUGUGCUUGUGUGAAACAGGAGUUGUGGAUGGACAUCACGCUCCUGUCUGGUCCUCACAUCUACAGGAUGG
Get precursor sequence
Structure
        10          20        30         40        50          
CUGUCUGGUUUGAUACUGA--   U    U  -|   U     AA           UGCUUG 
                     CGG CAGG GC UGAU GUCCA  CGCAAUUCUUG      \
                     GUC GUCC CG ACUA CAGGU  GUGUUGAGGAC      U
GGUAGGACAUCUACACUCCUG   U    U  C^   -     AG           AAAGUG 
 .       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Mature sequence

Dre-Mir-219-P1a_5p

MirBase accessionMIMAT0001286
Sequence
0- UGAUUGUCCAAACGCAAUUCUUG -23
Get sequence
Validated targets TargetScanFish: dre-miR-219
Star sequence

Dre-Mir-219-P1a_3p*

MirBase accessionMIMAT0031989
Sequence
38- GGAGUUGUGGAUGGACAUCACGC -61
Get sequence