MirGeneDB

MirGeneDB ID

Dre-Mir-214-v1

Family name MIR-214 (all species)
Seed CAGCAGG
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-214
Paralogues Dre-Mir-214-v2 
Orthologues Aca-Mir-214-v1  Ami-Mir-214-v1  Bta-Mir-214-v1  Cfa-Mir-214-v1  Cli-Mir-214-v1  Cpi-Mir-214-v1  Cpo-Mir-214-v1  Dno-Mir-214-v1  Ete-Mir-214-v1  Gga-Mir-214-v1  Hsa-Mir-214-v1  Mdo-Mir-214-v1  Mml-Mir-214-v1  Mmu-Mir-214-v1  Oan-Mir-214-v1  Ocu-Mir-214-v1  Rno-Mir-214-v1  Sha-Mir-214-v1  Sto-Mir-214-v1  Tgu-Mir-214-v1  Xtr-Mir-214-v1 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Gnathostomata
Genome context
(danRer11)
chr20: 14877660-14877721 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-214-v1)
Mir-199-P3-v1 chr20: 14875474-14875534 [+] UCSC Ensembl
Mir-199-P3-v2 chr20: 14875474-14875534 [+] UCSC Ensembl
Mir-199-P3-v3 chr20: 14875474-14875534 [+] UCSC Ensembl
Mir-214-v1 chr20: 14877660-14877721 [+] UCSC Ensembl
Mir-214-v2 chr20: 14877660-14877721 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGCUGCCAUUGACUGAGAGCGUUGUCUGUCUGCCUGUCUACACUUGCUGUGCAGAACUUCCUGCACCUGUACAGCAGGCACAGACAGGCAGACAGAUGGCAGCCCGCCUGACAGGCCACACA
Get precursor sequence
Structure
        10         20         30        40        50        60
UGCUGCCAUUGACUGAGA-  -| UG               ACA          AGAACUU 
                   GC GU  UCUGUCUGCCUGUCU   CUUGCUGUGC       C
                   CG CG  AGACAGACGGACAGA   GGACGACAUG       C
ACACACCGGACAGUCCGCC  A^ GU               CAC          UCCACGU 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-214-v1_5p*

MirBase accessionNone
Sequence
0- UGCCUGUCUACACUUGCUGUGC -22
Get sequence
Mature sequence

Dre-Mir-214-v1_3p

MirBase accessionMIMAT0001283
Sequence
40- ACAGCAGGCACAGACAGGCAGA -62
Get sequence
Validated targets TargetScanFish: dre-miR-214