MirGeneDB

MirGeneDB ID

Dre-Mir-208-P2

Family name MIR-208 (all species)
Seed UAAGACG
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-736
Paralogues
Orthologues Bta-Mir-208-P2  Cfa-Mir-208-P2  Cpo-Mir-208-P2  Dno-Mir-208-P2  Ete-Mir-208-P2a  Ete-Mir-208-P2b  Hsa-Mir-208-P2  Mdo-Mir-208-P2  Mml-Mir-208-P2  Mmu-Mir-208-P2  Ocu-Mir-208-P2  Rno-Mir-208-P2  Sha-Mir-208-P2  Sto-Mir-208-P2 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Vertebrata
Genome context
(danRer11)
chr2: 24261228-24261283 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUUUAAGGUUUAACUUCUCUACUGACAGAGAAGCUUUUUGUUUGUGUUAUGUUUAUUUUCAAAUGUAAGACGAACAAAAAGUUUUUCUGUUAGUAGGCCAAGCUUCCCUAAACAGA
Get precursor sequence
Structure
        10          20        30        40        50       
CUUUAAGGUUUAACUUC--|                           G      UUAU 
                   UCUACUGACAGAGAAGCUUUUUGUUUGU UUAUGU    U
                   GGAUGAUUGUCUUUUUGAAAAACAAGCA AAUGUA    U
AGACAAAUCCCUUCGAACC^                           G      AACU 
    110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-208-P2_5p*

MirBase accessionNone
Sequence
0- AAGCUUUUUGUUUGUGUUAUGU -22
Get sequence
Mature sequence

Dre-Mir-208-P2_3p

MirBase accessionMIMAT0003767
Sequence
34- GUAAGACGAACAAAAAGUUUUU -56
Get sequence
Validated targets TargetScanFish: dre-miR-736