MirGeneDB

MirGeneDB ID

Dre-Mir-205-P1

Family name MIR-205 (all species)
Seed CCUUCAU
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-205
Paralogues
Orthologues Aca-Mir-205-P1  Ami-Mir-205-P1  Bta-Mir-205-P1  Cfa-Mir-205-P1  Cli-Mir-205-P1  Cpi-Mir-205-P1  Cpo-Mir-205-P1  Dno-Mir-205-P1  Ete-Mir-205-P1  Gga-Mir-205-P1  Hsa-Mir-205-P1  Mdo-Mir-205-P1  Mml-Mir-205-P1  Mmu-Mir-205-P1  Oan-Mir-205-P1  Ocu-Mir-205-P1  Rno-Mir-205-P1  Sha-Mir-205-P1  Sto-Mir-205-P1  Tgu-Mir-205-P1a  Tgu-Mir-205-P1b  Xtr-Mir-205-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(danRer11)
chr23: 33290291-33290350 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GUGGAUGGCCUAAAACUACUGUGCAUUCUAUCCUUCAUUCCACCGGAGUCUGUGUAGUUGUUCAAUCAGAUUUCAGUGGUGUGAAGUGUAGGAAACACGGAAAGAUCGCAUCCCUUUCUG
Get precursor sequence
Structure
        10          20        30        40        50         
GUGGAUGGCCUAAAACUA--|    CA     UC      U    C        UGUAGU 
                    CUGUG  UUCUA  CUUCAU CCAC GGAGUCUG      U
                    GGCAC  AGGAU  GAAGUG GGUG CUUUAGAC      G
GUCUUUCCCUACGCUAGAAA^    AA     GU      U    A        UAACUU 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Mature sequence

Dre-Mir-205-P1_5p

MirBase accessionMIMAT0001280
Sequence
0- UCCUUCAUUCCACCGGAGUCUG -22
Get sequence
Validated targets TargetScanFish: dre-miR-205
Star sequence

Dre-Mir-205-P1_3p*

MirBase accessionMIMAT0031925
Sequence
38- GAUUUCAGUGGUGUGAAGUGUA -60
Get sequence