
MirGeneDB ID


Family name MIR-193 (all species)
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-365-2
Paralogues Dre-Mir-193-P1a1  Dre-Mir-193-P1a2  Dre-Mir-193-P1b  Dre-Mir-193-P2a2  Dre-Mir-193-P2b1 
Orthologues Aca-Mir-193-P2a  Ami-Mir-193-P2a  Bge-Mir-193-P2  Bta-Mir-193-P2a  Cbr-Mir-193-P2-v1  Cbr-Mir-193-P2-v2  Cel-Mir-193-P2-v1  Cel-Mir-193-P2-v2  Cfa-Mir-193-P2a  Cgi-Mir-193-P2  Cli-Mir-193-P2a  Cpi-Mir-193-P2a  Cpo-Mir-193-P2a  Cte-Mir-193-P2  Dno-Mir-193-P2a  Ete-Mir-193-P2a  Gga-Mir-193-P2a  Hme-Mir-193-P2  Hsa-Mir-193-P2a  Lgi-Mir-193-P2  Mml-Mir-193-P2a  Mmu-Mir-193-P2a  Oan-Mir-193-P2a  Ocu-Mir-193-P2a  Pfl-Mir-193-P2  Pmi-Mir-193-P2  Rno-Mir-193-P2a  Sha-Mir-193-P2a  Sko-Mir-193-P2  Tca-Mir-193-P2  Tgu-Mir-193-P2a 
Node of Origin (locus) D. rerio
Node of Origin (family) Bilateria
Genome context
chr3: 35961006-35961067 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-193-P2a1)
Mir-193-P1a1 chr3: 35959932-35959993 [+] UCSC Ensembl
Mir-193-P2a1 chr3: 35961006-35961067 [+] UCSC Ensembl
(pre-Mir +30nt flank)
Get precursor sequence
        10           20        30        40        50        60 
AAGAGGACCCAAAAGGCA---|     AA        AC           GC    UUUUAUU 
                     GCAAGA  AAUGAGGG  UUUUAGGGGCA  UGUG       \
                     CGUUCU  UUAUUCCU  AAAAUCCCCGU  AUAC       A
GUGCGUCCCUGCGACUUUUAA^     CG        A-           A-    UGACCCA 
120       110       100        90         80         70
Deep sequencing
Go to detailed chart
CommentThere is a second Drosha site on the 5p arm -1 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence


MirBase accessionNone
Get sequence
Mature sequence


MirBase accessionMIMAT0001875
Get sequence
Validated targets TargetScanFish: dre-miR-365