MirGeneDB

MirGeneDB ID

Dre-Mir-19-P2b1

Family name MIR-19 (all species)
Seed GUGCAAA
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-19c
Paralogues Dre-Mir-19-P1a  Dre-Mir-19-P2a1  Dre-Mir-19-P2c 
Orthologues Aca-Mir-19-P2b  Bta-Mir-19-P2b  Cfa-Mir-19-P2b  Cli-Mir-19-P2b  Cpi-Mir-19-P2b  Cpo-Mir-19-P2b  Dno-Mir-19-P2b  Ete-Mir-19-P2b  Gga-Mir-19-P2b  Hsa-Mir-19-P2b  Mdo-Mir-19-P2b  Mml-Mir-19-P2b  Mmu-Mir-19-P2b  Oan-Mir-19-P2b  Ocu-Mir-19-P2b  Rno-Mir-19-P2b  Sha-Mir-19-P2b  Sto-Mir-19-P2b  Tgu-Mir-19-P2b  Xtr-Mir-19-P2b 
Node of Origin (locus) D. rerio
Node of Origin (family) Vertebrata
Genome context
(danRer11)
chr14: 31467045-31467105 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-19-P2b1)
Mir-92-P2b1 chr14: 31466699-31466769 [-] UCSC Ensembl
Mir-19-P2b1 chr14: 31467045-31467105 [-] UCSC Ensembl
Mir-17-P3b1 chr14: 31467183-31467241 [-] UCSC Ensembl
Mir-17-P2b1 chr14: 31467386-31467450 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCUUAUGGAAAAGCCCUGUUAUCUGGGGUGAGUUUUGCAGGAUUGCAUCCGGCUUUAUUACAACAUGCUGUGCAAAUCCAUGCAAAACUCGCUGCGCCAGGGACAAACCACUUCUACAAUC
Get precursor sequence
Structure
        10        20           30         40         50          
GCUUAUGGAAAAGCCCUGUUA     ---             -   -|    UC    UUUAUU 
                     UCUGG   GGUGAGUUUUGCA GGA UUGCA  CGGC      \
                     GGACC   UCGCUCAAAACGU CCU AACGU  GUCG      A
CUAACAUCUUCACCAAACAG-     GCG             A   A^    --    UACAAC 
 .       110        100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-19-P2b1_5p*

MirBase accessionMIMAT0031940
Sequence
0- AGUUUUGCAGGAUUGCAUCCGGC -23
Get sequence
Mature sequence

Dre-Mir-19-P2b1_3p

MirBase accessionMIMAT0001784
Sequence
38- UGUGCAAAUCCAUGCAAAACUCG -61
Get sequence
Validated targets TargetScanFish: dre-miR-19c