MirGeneDB

MirGeneDB ID

Dre-Mir-140-v1

Family name MIR-140 (all species)
Seed CCACAGG
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-140
Paralogues Dre-Mir-140-v2 
Orthologues Aca-Mir-140-v1  Ami-Mir-140-v1  Bta-Mir-140-v1  Cfa-Mir-140-v1  Cli-Mir-140-v1  Cpi-Mir-140-v1  Cpo-Mir-140-v1  Dno-Mir-140-v1  Ete-Mir-140-v1  Gga-Mir-140-v1  Hsa-Mir-140-v1  Mdo-Mir-140-v1  Mml-Mir-140-v1  Mmu-Mir-140-v1  Oan-Mir-140-v1  Ocu-Mir-140-v1  Rno-Mir-140-v1  Sha-Mir-140-v1  Sto-Mir-140-v1  Tgu-Mir-140-v1  Xtr-Mir-140-v1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(danRer11)
chr25: 34791384-34791445 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-140-v1)
Mir-140-v1 chr25: 34791384-34791445 [+] UCSC Ensembl
Mir-140-v2 chr25: 34791384-34791445 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUGUGUCUGUGUUUGUCUCCUGUGUCCCGUCAGUGGUUUUACCCUAUGGUAGGUUACGUCAUGCUGUUCUACCACAGGGUAGAACCACGGACGGGAUGUCUGGAGGUGUCUGCGUCGCCCUG
Get precursor sequence
Structure
        10         20         30        40        50        60
CUGUGUCUGUGUUUGUC-   U-|UG       A             A      GUUACGU 
                  UCC  G  UCCCGUC GUGGUUUUACCCU UGGUAG       C
                  AGG  U  AGGGCAG CACCAAGAUGGGA ACCAUC       A
GUCCCGCUGCGUCUGUGG   UC^GU       G             C      UUGUCGU 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-140-v1_5p*

MirBase accessionMIMAT0001836
Sequence
0- CAGUGGUUUUACCCUAUGGUAG -22
Get sequence
Validated targets TargetScanFish: dre-miR-140
Mature sequence

Dre-Mir-140-v1_3p

MirBase accessionMIMAT0003159
Sequence
40- ACCACAGGGUAGAACCACGGAC -62
Get sequence