MirGeneDB

MirGeneDB ID

Dre-Mir-130-P3b2

Family name MIR-130 (all species)
Seed AGUGCAA
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-130c-2
Paralogues Dre-Mir-130-P1b1  Dre-Mir-130-P2a1  Dre-Mir-130-P2b1  Dre-Mir-130-P2b2  Dre-Mir-130-P3a1  Dre-Mir-130-P3b1  Dre-Mir-130-P4a  Dre-Mir-130-P4b 
Orthologues Aca-Mir-130-P3b  Ami-Mir-130-P3b  Cli-Mir-130-P3b  Cpi-Mir-130-P3b  Gga-Mir-130-P3b  Oan-Mir-130-P3b  Sto-Mir-130-P3b  Tgu-Mir-130-P3b  Xtr-Mir-130-P3b 
Node of Origin (locus) D. rerio
Node of Origin (family) Vertebrata
Genome context
(danRer11)
chr5: 13288840-13288898 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-130-P3b2)
Mir-130-P3b2 chr5: 13288840-13288898 [+] UCSC Ensembl
Mir-130-P2b1 chr5: 13289363-13289425 [+] UCSC Ensembl
Mir-130-P4b chr5: 13296331-13296395 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCAGUUUCUUUACUGUUGUUGUUGACCAGGGCCCUUUUUCUGUUGUACUACUGUGCAGUCAGAUGAGCAGUGCAAUAUUAAAAGGGCAUUGGCUGACAAAAAAAGAGGAAAGAAAGAAA
Get precursor sequence
Structure
        10          20        30        40        50         
UCAGUUUCUUUACUGUUG--|    GA    G        UC         A  GUGCAG 
                    UUGUU  CCAG GCCCUUUU  UGUUGUACU CU      \
                    AACAG  GGUU CGGGAAAA  AUAACGUGA GA      U
AAAGAAAGAAAGGAGAAAAA^    UC    A        UU         C  GUAGAC 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), UGUG in loop
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-130-P3b2_5p*

MirBase accessionMIMAT0031969
Sequence
0- GCCCUUUUUCUGUUGUACUACU -22
Get sequence
Mature sequence

Dre-Mir-130-P3b2_3p

MirBase accessionMIMAT0001828
Sequence
37- CAGUGCAAUAUUAAAAGGGCAU -59
Get sequence
Validated targets TargetScanFish: dre-miR-130c