MirGeneDB

MirGeneDB ID

Dpu-Mir-9-o15

Family name MIR-9 (all species)
Seed CUUUGGU
Species Common water flea (Daphnia pulex)
MiRBase ID dpu-mir-9
Paralogues Dpu-Mir-9-o16 
Orthologues Cin-Mir-9  Cte-Mir-9  Efe-Mir-9-P15  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Pmi-Mir-9  Spu-Mir-9 
Node of Origin (locus) D. pulex
Node of Origin (family) Bilateria
Genome context
(Daphnia_pulex.V1.0)
DAPPUscaffold_2: 1526213-1526273 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
CGUGUCGUGGUCGUCAUGGCGCUGCUUUUUUCUUUGGUUAUCUAGCUGUAUGAGUGUUAGAAGACGUCAUAAAGCUAGGUUACCAAAGUUAAGAACUGCCCCUCUUCAUCGGCUAUUUUCU
Get precursor sequence
Structure
        10            20        30        40        50          
CGUGUCGUGGUCGUCAU----|   CUG   UUUU       U        G     GUGUUA 
                     GGCG   CUU    CUUUGGU AUCUAGCU UAUGA      \
                     CCGU   GAA    GAAACCA UGGAUCGA AUACU      G
UCUUUUAUCGGCUACUUCUCC^   CAA   UU--       U        A     GCAGAA 
 .       110       100        90          80        70
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer site -1 relative to what is annotated here.
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Mature sequence

Dpu-Mir-9-o15_5p

MirBase accessionMIMAT0012671
Sequence
0- UCUUUGGUUAUCUAGCUGUAUGA -23
Get sequence
Star sequence

Dpu-Mir-9-o15_3p*

MirBase accessionNone
Sequence
38- AUAAAGCUAGGUUACCAAAGUUA -61
Get sequence