MirGeneDB

MirGeneDB ID

Dpu-Mir-279-o5

Family name MIR-279 (all species)
Seed GACUAGA
Species Common water flea (Daphnia pulex)
MiRBase ID
Paralogues Dpu-Mir-279-o1  Dpu-Mir-279-o2  Dpu-Mir-279-o3  Dpu-Mir-279-o4  Dpu-Mir-279-o6 
Orthologues Cgi-Mir-279  Isc-Mir-279  Lgi-Mir-279 
Node of Origin (locus) D. pulex
Node of Origin (family) Protostomia
Genome context
(Daphnia_pulex.V1.0)
DAPPUscaffold_62: 283702-283760 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
CAUAUGUUUAACUGUAUGUCCUCAGUACUGAGUGAGUGUUGGUCUAGAACACAGUGAUAUAAUUUGUGACUAGAUUUUUACACUCACCAAGUAAGGUGGAAGAUAACGUCGUUAAGCCU
Get precursor sequence
Structure
        10         20        30        40          50         
CAUAUGUUUAACUGUAUG-   UCAG    GA        U--|      AA    GUGAU 
                   UCC    UACU  GUGAGUGU   GGUCUAG  CACA     \
                   AGG    AUGA  CACUCACA   UUAGAUC  GUGU     A
UCCGAAUUGCUGCAAUAGA   UGGA    AC        UUU^      A-    UUAAU 
       110       100        90        80        70         60
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-279 genes were present in the last common ancestor of protostomes and how the Drosophila Mir-279s relate to the other invertebrate Mir-279s and thus these multiple paralogues in invertebrates are classified here as orphans pending new data.
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Star sequence

Dpu-Mir-279-o5_5p*

MirBase accessionNone
Sequence
0- AGUGAGUGUUGGUCUAGAACACA -23
Get sequence
Mature sequence

Dpu-Mir-279-o5_3p

MirBase accessionNone
Sequence
36- UGACUAGAUUUUUACACUCACCA -59
Get sequence