MirGeneDB

MirGeneDB ID

Dpu-Mir-279-o3

Family name MIR-279 (all species)
Seed GACUAGA
Species Common water flea (Daphnia pulex)
MiRBase ID
Paralogues Dpu-Mir-279-o1  Dpu-Mir-279-o2  Dpu-Mir-279-o4  Dpu-Mir-279-o5  Dpu-Mir-279-o6 
Orthologues Aae-Mir-279-P3  Cgi-Mir-279  Dan-Mir-279-P3  Dme-Mir-279-P3  Dmo-Mir-279-P3  Isc-Mir-279  Lgi-Mir-279 
Node of Origin (locus) D. pulex
Node of Origin (family) Protostomia
Genome context
(Daphnia_pulex.V1.0)
DAPPUscaffold_43: 177095-177172 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UUUGCUUUAUUCAACAAUCCAGUCGCGUUCGGUGGAUAUGGUUCUCGUGACAUGGCUUUUCAUCGGCUUUGUAUUCCGAGCGUACAUGACUAGAUCCAUACUCACCAGACGAGGCUGGACCAAUCAUCGAAAGCUCUU
Get precursor sequence
Structure
        10          20        30        40        50        60         
UUUGCUUUAUUCAACAA--|      G   UC    GA     U   C  GA    GCUUUUCAUCGGCU 
                   UCCAGUC CGU  GGUG  UAUGG UCU GU  CAUG              U
                   AGGUCGG GCA  CCAC  AUACC AGA CA  GUAC              U
UUCUCGAAAGCUACUAACC^      A   GA    UC     U   U  --    AUGCGAGCCUUAUG 
      130       120       110       100        90          80        70
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-279 genes were present in the last common ancestor of protostomes and how the Drosophila Mir-279s relate to the other invertebrate Mir-279s and thus these multiple paralogues in invertebrates are classified here as orphans pending new data. Note that there is a second Drosha site +2 on the 5p arm relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Dpu-Mir-279-o3_5p*

MirBase accessionNone
Sequence
0- GGUGGAUAUGGUUCUCGUGACAUG -24
Get sequence
Mature sequence

Dpu-Mir-279-o3_3p

MirBase accessionNone
Sequence
56- UGACUAGAUCCAUACUCACCAG -78
Get sequence