MirGeneDB

MirGeneDB ID

Dno-Mir-92-P2b

Family name MIR-92 (all species)
Seed AUUGCAC
Species Nine-banded armadillo (Dasypus novemcinctus)
MiRBase ID dno-mir-363
Paralogues Dno-Mir-92-P1a  Dno-Mir-92-P1b  Dno-Mir-92-P1c  Dno-Mir-92-P2a  Dno-Mir-92-P2c 
Orthologues Aca-Mir-92-P2b  Asu-Mir-92  Bfl-Mir-92-o2b  Bta-Mir-92-P2b  Cel-Mir-92  Cfa-Mir-92-P2b  Cli-Mir-92-P2b  Cpi-Mir-92-P2b  Cpo-Mir-92-P2b  Dre-Mir-92-P2b1  Ete-Mir-92-P2b  Gga-Mir-92-P2b  Hsa-Mir-92-P2b  Isc-Mir-92  Mdo-Mir-92-P2b  Mml-Mir-92-P2b  Mmu-Mir-92-P2b  Oan-Mir-92-P2b  Ocu-Mir-92-P2b  Rno-Mir-92-P2b  Sha-Mir-92-P2b  Sto-Mir-92-P2b  Tgu-Mir-92-P2b  Xtr-Mir-92-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(dasNov3)
JH573198: 1053115-1053179 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-92-P2b)
Mir-17-P1b JH573198: 1052307-1052364 [+] UCSC Ensembl
Mir-17-P2b JH573198: 1052463-1052527 [+] UCSC Ensembl
Mir-17-P3b JH573198: 1052698-1052758 [+] UCSC Ensembl
Mir-19-P2b JH573198: 1052822-1052884 [+] UCSC Ensembl
Mir-92-P1b JH573198: 1052961-1053022 [+] UCSC Ensembl
Mir-92-P2b JH573198: 1053115-1053179 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CAAUUGUAAAAUGACCUGUUUUGCUGUUGUCGGGUGGAUCACGAUGCAAUUUUGAUUAGUAUAAUAGGAGAAAAAUUGCACGGUAUCCAUCUGUAAACCGCAGGACCUUUCUUGACAACAUUCUU
Get precursor sequence
Structure
        10          20        30        40        50        60  
CAAUUGUAAAAUGACCU--|      U   GU         CA  A         GAUUAGUA 
                   GUUUUGC GUU  CGGGUGGAU  CG UGCAAUUUU        U
                   CAGGACG CAA  GUCUACCUA  GC ACGUUAAAA        A
UUCUUACAACAGUUCUUUC^      C   AU         UG  -         AGAGGAUA 
   120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
To
Star sequence

Dno-Mir-92-P2b_5p* (predicted)

MirBase accessionMIMAT0047833
Sequence
0- CGGGUGGAUCACGAUGCAAUUUU -23
Get sequence
Mature sequence

Dno-Mir-92-P2b_3p

MirBase accessionMIMAT0047834
Sequence
43- AAUUGCACGGUAUCCAUCUGUA -65
Get sequence