MirGeneDB

MirGeneDB ID

Dno-Mir-33-P2

Family name MIR-33 (all species)
Seed UGCAUUG
Species Nine-banded armadillo (Dasypus novemcinctus)
MiRBase ID dno-mir-33b
Paralogues Dno-Mir-33-P1 
Orthologues Aae-Mir-33  Aca-Mir-33-P2  Ami-Mir-33-P2  Bge-Mir-33  Bta-Mir-33-P2  Cfa-Mir-33-P2  Cgi-Mir-33  Cin-Mir-33  Cli-Mir-33-P2  Cpi-Mir-33-P2  Cpo-Mir-33-P2  Cte-Mir-33  Dan-Mir-33  Dme-Mir-33  Dmo-Mir-33  Dpu-Mir-33  Dre-Mir-33-P2  Efe-Mir-33  Ete-Mir-33-P2  Gga-Mir-33-P2  Hsa-Mir-33-P2  Isc-Mir-33  Lgi-Mir-33  Mml-Mir-33-P2  Oan-Mir-33-P2  Ocu-Mir-33-P2  Pfl-Mir-33  Pmi-Mir-33  Sko-Mir-33  Spu-Mir-33  Sto-Mir-33-P2  Tca-Mir-33  Xtr-Mir-33-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(dasNov3)
JH565112: 379000-379055 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CGGGGCCCUGGAGAGGCGGGCGGCCCCGCGGUGCAUUGCUGUUGCGUUGCACGUGUGUGCGGGUGCAGUGCCUCUGCAGUGCAGCCCGGAGCCGGCCCCUGGCGCCGCAGGCUCCG
Get precursor sequence
Structure
        10         20         30         40        50       
CGGGGCCCUGGAGAGGC-   -|   C   C  -        UGUU        CGUGU 
                  GGG CGGC CCG GG UGCAUUGC    GCGUUGCA     G
                  CCC GCCG GGC CC ACGUGACG    CGUGACGU     U
GCCUCGGACGCCGCGGUC   G^   A   -  G        UCUC        GGGCG 
    110       100        90         80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Dno-Mir-33-P2_5p

MirBase accessionMIMAT0047573
Sequence
0- GUGCAUUGCUGUUGCGUUGCA -21
Get sequence
Star sequence

Dno-Mir-33-P2_3p*

MirBase accessionMIMAT0047574
Sequence
35- CAGUGCCUCUGCAGUGCAGCC -56
Get sequence