MirGeneDB

MirGeneDB ID

Dno-Mir-23-P1

Family name MIR-23 (all species)
Seed UCACAUU
Species Nine-banded armadillo (Dasypus novemcinctus)
MiRBase ID dno-mir-23a
Paralogues Dno-Mir-23-P2 
Orthologues Aca-Mir-23-P1  Ami-Mir-23-P1  Bta-Mir-23-P1  Cfa-Mir-23-P1  Cpi-Mir-23-P1  Cpo-Mir-23-P1  Dre-Mir-23-P1  Ete-Mir-23-P1  Hsa-Mir-23-P1  Mdo-Mir-23-P1  Mml-Mir-23-P1  Mmu-Mir-23-P1  Oan-Mir-23-P1  Rno-Mir-23-P1  Sha-Mir-23-P1  Sto-Mir-23-o1  Sto-Mir-23-P1  Xtr-Mir-23-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(dasNov3)
AAGV03195862: 168-225 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-23-P1)
Mir-23-P1 AAGV03195862: 168-225 [+] UCSC Ensembl
Mir-27-P1 AAGV03195862: 315-376 [+] UCSC Ensembl
Mir-24-P1 AAGV03195862: 467-526 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGCCCCGAGCUCUCUGUGCCACGGACGGCUGGGGUUCCUGGGGAUGGGAUUUGCUGUCGGUCACAAAUCACAUUGCCAGGGAUUUCCAACUGACCGUGAGCCCUACCUCCUAUGGUGU
Get precursor sequence
Structure
        10         20        30         40        50        
UGCCCCGAGCUCUCUGUGC-     A   C   -|        G    G     GCUGU 
                    CACGG CGG UGG GGUUCCUGG GAUG GAUUU     C
                    GUGCC GUC ACC UUAGGGACC UUAC CUAAA     G
UGUGGUAUCCUCCAUCCCGA     A   A   U^        G    A     CACUG 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Dno-Mir-23-P1_5p* (predicted)

MirBase accessionMIMAT0047528
Sequence
0- GGGGUUCCUGGGGAUGGGAUUU -22
Get sequence
Mature sequence

Dno-Mir-23-P1_3p

MirBase accessionMIMAT0047529
Sequence
36- AUCACAUUGCCAGGGAUUUCCA -58
Get sequence