MirGeneDB

MirGeneDB ID

Dno-Mir-219-P1

Family name MIR-219 (all species)
Seed GAUUGUC
Species Nine-banded armadillo (Dasypus novemcinctus)
MiRBase ID dno-mir-219a
Paralogues Dno-Mir-219-P2  Dno-Mir-219-P2-as 
Orthologues Aae-Mir-219  Aca-Mir-219-P1  Ami-Mir-219-P1  Bfl-Mir-219  Bge-Mir-219  Bta-Mir-219-P1  Cfa-Mir-219-P1  Cgi-Mir-219  Cin-Mir-219  Cpi-Mir-219-P1  Cpo-Mir-219-P1  Cte-Mir-219  Dan-Mir-219  Dme-Mir-219  Dmo-Mir-219  Dpu-Mir-219  Dre-Mir-219-P1a  Ete-Mir-219-P1  Hsa-Mir-219-P1  Isc-Mir-219  Lan-Mir-219  Mdo-Mir-219-P1  Mml-Mir-219-P1  Mmu-Mir-219-P1  Mmu-Mir-219-P1-as  Ocu-Mir-219-P1  Pfl-Mir-219  Pmi-Mir-219  Rno-Mir-219-P1  Sha-Mir-219-P1  Sko-Mir-219  Spu-Mir-219  Sto-Mir-219-P1-v1  Sto-Mir-219-P1-v2  Tca-Mir-219 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(dasNov3)
JH578991: 782596-782658 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCUCCCUCCCCCGCCCCGGGUCGCGGCUCUUGAUUGUCCAAACGCAAUUCUCGAGUCUCUGGAUCCGGCCGAGAGUUGAGUCUGGACGUCCCGAGCCGCCGCCCCCAGACUUCGAGGGAGAGA
Get precursor sequence
Structure
        10          20        30        40        50        60 
CCUCCCUCCCCCGCCCC--|   C       UU   U     A  G         AGUCUCU 
                   GGGU GCGGCUC  GAU GUCCA AC CAAUUCUCG       G
                   CCCG CGCCGAG  CUG CAGGU UG GUUGAGAGC       G
AGAGAGGGAGCUUCAGACC^   C       CC   -     C  A         CGGCCUA 
 120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Dno-Mir-219-P1_5p

MirBase accessionMIMAT0047771
Sequence
0- UGAUUGUCCAAACGCAAUUCUCG -23
Get sequence
Co-mature sequence

Dno-Mir-219-P1_3p

MirBase accessionMIMAT0047772
Sequence
41- AGAGUUGAGUCUGGACGUCCCG -63
Get sequence