MirGeneDB

MirGeneDB ID

Dno-Mir-205-P1

Family name MIR-205 (all species)
Seed CCUUCAU
Species Nine-banded armadillo (Dasypus novemcinctus)
MiRBase ID dno-mir-205
Paralogues
Orthologues Aca-Mir-205-P1  Ami-Mir-205-P1  Bta-Mir-205-P1  Cfa-Mir-205-P1  Cli-Mir-205-P1  Cpi-Mir-205-P1  Cpo-Mir-205-P1  Dre-Mir-205-P1  Ete-Mir-205-P1  Gga-Mir-205-P1  Hsa-Mir-205-P1  Mdo-Mir-205-P1  Mml-Mir-205-P1  Mmu-Mir-205-P1  Oan-Mir-205-P1  Ocu-Mir-205-P1  Rno-Mir-205-P1  Sha-Mir-205-P1  Sto-Mir-205-P1  Tgu-Mir-205-P1a  Tgu-Mir-205-P1b  Xtr-Mir-205-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(dasNov3)
JH570311: 3472382-3472440 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAUCCCUAGACAAUCCAUGUGUUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACGCCGCCACCACCA
Get precursor sequence
Structure
        10            20        30        40        50         
GAUCCCUAGACAAUCCAU----|   UU      UC           C        UCUCAU 
                      GUGU  CUCUUG  CUUCAUUCCAC GGAGUCUG      \
                      UACG  GAGGAC  GAAGUGAGGUG CUUUAGAC      A
ACCACCACCGCCGCAGUCGAGG^   --      UU           A        CAACCC 
       110       100          90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Dno-Mir-205-P1_5p

MirBase accessionMIMAT0047746
Sequence
0- UCCUUCAUUCCACCGGAGUCUG -22
Get sequence
Star sequence

Dno-Mir-205-P1_3p* (predicted)

MirBase accessionMIMAT0047747
Sequence
37- GAUUUCAGUGGAGUGAAGUUCA -59
Get sequence