MirGeneDB

MirGeneDB ID

Dno-Mir-19-P2b

Family name MIR-19 (all species)
Seed GUGCAAA
Species Nine-banded armadillo (Dasypus novemcinctus)
MiRBase ID dno-mir-19b-2
Paralogues Dno-Mir-19-P1  Dno-Mir-19-P2a 
Orthologues Aca-Mir-19-P2b  Bta-Mir-19-P2b  Cfa-Mir-19-P2b  Cli-Mir-19-P2b  Cpi-Mir-19-P2b  Cpo-Mir-19-P2b  Dre-Mir-19-P2b1  Ete-Mir-19-P2b  Gga-Mir-19-P2b  Hsa-Mir-19-P2b  Mdo-Mir-19-P2b  Mml-Mir-19-P2b  Mmu-Mir-19-P2b  Oan-Mir-19-P2b  Ocu-Mir-19-P2b  Rno-Mir-19-P2b  Sha-Mir-19-P2b  Sto-Mir-19-P2b  Tgu-Mir-19-P2b  Xtr-Mir-19-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(dasNov3)
JH573198: 1052822-1052884 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-19-P2b)
Mir-17-P1b JH573198: 1052307-1052364 [+] UCSC Ensembl
Mir-17-P2b JH573198: 1052463-1052527 [+] UCSC Ensembl
Mir-17-P3b JH573198: 1052698-1052758 [+] UCSC Ensembl
Mir-19-P2b JH573198: 1052822-1052884 [+] UCSC Ensembl
Mir-92-P1b JH573198: 1052961-1053022 [+] UCSC Ensembl
Mir-92-P2b JH573198: 1053115-1053179 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAGUGUUCCAAGACACUGCUACUUACAGUUAGUUUUGCAGGUUUGCAUUUCAGCAUACACAUAAUACGGCUGUGCAAAUCCAUGCAAAACUGAUUGUGAUAGUGUAUGCUGUCUACAGCGUUA
Get precursor sequence
Structure
        10           20        30         40         50        60 
GAGUGUUCCAAGACACU---    C                 -  -|     UUU    AUACAC 
                    GCUA UUACAGUUAGUUUUGCA GG UUUGCA   CAGC      A
                    UGAU AGUGUUAGUCAAAACGU CC AAACGU   GUCG      U
AUUGCGACAUCUGUCGUAUG    -                 A  U^     ---    GCAUAA 
 120       110       100         90        80           70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
To
Star sequence

Dno-Mir-19-P2b_5p* (predicted)

MirBase accessionMIMAT0047519
Sequence
0- AGUUUUGCAGGUUUGCAUUUCAGC -24
Get sequence
Mature sequence

Dno-Mir-19-P2b_3p

MirBase accessionMIMAT0047518
Sequence
40- UGUGCAAAUCCAUGCAAAACUGA -63
Get sequence