MirGeneDB

MirGeneDB ID

Dno-Mir-19-P1

Family name MIR-19 (all species)
Seed GUGCAAA
Species Nine-banded armadillo (Dasypus novemcinctus)
MiRBase ID dno-mir-19a
Paralogues Dno-Mir-19-P2a  Dno-Mir-19-P2b 
Orthologues Aca-Mir-19-P1  Ami-Mir-19-P1  Bta-Mir-19-P1  Cfa-Mir-19-P1  Cli-Mir-19-P1  Cpi-Mir-19-P1  Cpo-Mir-19-P1  Dre-Mir-19-P1a  Ete-Mir-19-P1  Gga-Mir-19-P1  Hsa-Mir-19-P1  Mdo-Mir-19-P1  Mml-Mir-19-P1  Mmu-Mir-19-P1  Oan-Mir-19-P1  Ocu-Mir-19-P1  Rno-Mir-19-P1  Sha-Mir-19-P1  Sto-Mir-19-P1  Tgu-Mir-19-P1  Xtr-Mir-19-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(dasNov3)
JH570327: 92615-92672 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-19-P1)
Mir-17-P1a JH570327: 92325-92384 [+] UCSC Ensembl
Mir-17-P2a JH570327: 92464-92527 [+] UCSC Ensembl
Mir-19-P1 JH570327: 92615-92672 [+] UCSC Ensembl
Mir-17-P3a JH570327: 92793-92851 [+] UCSC Ensembl
Mir-19-P2a JH570327: 92928-92988 [+] UCSC Ensembl
Mir-92-P1a JH570327: 93045-93103 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AAUAGAUUUUUUUGUUUGCAGUCCUCUGUUAGUUUUGCAUAGUUGCACUACAAGAAGAAUGUAGUUGUGCAAAUCUAUGCAAAACUGAUGGUGGCCUGUUAUUUCCUUCAAGUUUUUG
Get precursor sequence
Structure
        10          20        30        40          50       
AAUAGAUUUUUUUGUUU--    U  U                 --|     U  AAGAA 
                   GCAG CC CUGUUAGUUUUGCAUAG  UUGCAC AC     G
                   UGUC GG GGUAGUCAAAACGUAUC  AACGUG UG     A
GUUUUUGAACUUCCUUUAU    C  U                 UA^     U  AUGUA 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Dno-Mir-19-P1_5p*

MirBase accessionMIMAT0047515
Sequence
0- AGUUUUGCAUAGUUGCACUAC -21
Get sequence
Mature sequence

Dno-Mir-19-P1_3p

MirBase accessionMIMAT0047516
Sequence
35- UGUGCAAAUCUAUGCAAAACUGA -58
Get sequence