MirGeneDB

MirGeneDB ID

Dno-Mir-17-P3b

Family name MIR-17 (all species)
Seed AAAGUGC
Species Nine-banded armadillo (Dasypus novemcinctus)
MiRBase ID dno-mir-20b
Paralogues Dno-Mir-17-P1a  Dno-Mir-17-P1b  Dno-Mir-17-P1c  Dno-Mir-17-P2a  Dno-Mir-17-P2b  Dno-Mir-17-P3a  Dno-Mir-17-P3c 
Orthologues Aca-Mir-17-P3b  Bta-Mir-17-P3b  Cfa-Mir-17-P3b  Cli-Mir-17-P3b  Cpi-Mir-17-P3b  Cpo-Mir-17-P3b  Dre-Mir-17-P3b1  Ete-Mir-17-P3b  Gga-Mir-17-P3b  Hsa-Mir-17-P3b  Mdo-Mir-17-P3b  Mml-Mir-17-P3b  Mmu-Mir-17-P3b  Oan-Mir-17-P3b  Ocu-Mir-17-P3b  Rno-Mir-17-P3b  Sha-Mir-17-P3b  Tgu-Mir-17-P3b  Xtr-Mir-17-P3b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(dasNov3)
JH573198: 1052698-1052758 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-17-P3b)
Mir-17-P1b JH573198: 1052307-1052364 [+] UCSC Ensembl
Mir-17-P2b JH573198: 1052463-1052527 [+] UCSC Ensembl
Mir-17-P3b JH573198: 1052698-1052758 [+] UCSC Ensembl
Mir-19-P2b JH573198: 1052822-1052884 [+] UCSC Ensembl
Mir-92-P1b JH573198: 1052961-1053022 [+] UCSC Ensembl
Mir-92-P2b JH573198: 1053115-1053179 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACAAAGGAUGAGAUUGGGUCCUAGUAGUACCAAAGUGCUCAUAGUGCAGGUAGUUUUGGCAUUACUCUACUGUAGUGUGGGCACUUUAAGUACUCUUGGAUUACGUGUCUCUUGCUGGGGG
Get precursor sequence
Structure
        10           20        30         40        50          
ACAAAGGAUGAGAUUGG---|   U  U     C-            G     G   UUUUGG 
                    GUCC AG AGUAC  AAAGUGCUCAUA UGCAG UAG      \
                    UAGG UC UCAUG  UUUCACGGGUGU AUGUC AUC      C
GGGGGUCGUUCUCUGUGCAU^   U  -     AA            G     -   UCAUUA 
 .       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Mature sequence

Dno-Mir-17-P3b_5p

MirBase accessionMIMAT0047522
Sequence
0- CAAAGUGCUCAUAGUGCAGGUAG -23
Get sequence
Star sequence

Dno-Mir-17-P3b_3p*

MirBase accessionMIMAT0047523
Sequence
38- ACUGUAGUGUGGGCACUUUAAGU -61
Get sequence