MirGeneDB

MirGeneDB ID

Dno-Mir-17-P2b

Family name MIR-17 (all species)
Seed AAGGUGC
Species Nine-banded armadillo (Dasypus novemcinctus)
MiRBase ID dno-mir-18b
Paralogues Dno-Mir-17-P1a  Dno-Mir-17-P1b  Dno-Mir-17-P1c  Dno-Mir-17-P2a  Dno-Mir-17-P3a  Dno-Mir-17-P3b  Dno-Mir-17-P3c 
Orthologues Aca-Mir-17-P2b  Bta-Mir-17-P2b  Cfa-Mir-17-P2b  Cli-Mir-17-P2b  Cpi-Mir-17-P2b  Cpo-Mir-17-P2b  Dre-Mir-17-P2b1  Ete-Mir-17-P2b  Gga-Mir-17-P2b  Hsa-Mir-17-P2b  Mdo-Mir-17-P2b  Mml-Mir-17-P2b  Mmu-Mir-17-P2b  Oan-Mir-17-P2b  Ocu-Mir-17-P2b  Rno-Mir-17-P2b  Sha-Mir-17-P2b  Sto-Mir-17-P2b  Tgu-Mir-17-P2b  Xtr-Mir-17-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(dasNov3)
JH573198: 1052463-1052527 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-17-P2b)
Mir-17-P1b JH573198: 1052307-1052364 [+] UCSC Ensembl
Mir-17-P2b JH573198: 1052463-1052527 [+] UCSC Ensembl
Mir-17-P3b JH573198: 1052698-1052758 [+] UCSC Ensembl
Mir-19-P2b JH573198: 1052822-1052884 [+] UCSC Ensembl
Mir-92-P1b JH573198: 1052961-1053022 [+] UCSC Ensembl
Mir-92-P2b JH573198: 1053115-1053179 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUUGAGCUGUUCCUUAUUUGCCUCUUGUGUUAAGGUGCAUCUAGUGCAGUUAGUGAAACAGCUUAGAAUCUACUGCCCUAAAUGCCCCUUCUGGCACAGGCUGCCUAAUAUACAGCAUUUUAAAA
Get precursor sequence
Structure
        10          20        30          40        50        60 
UUUGAGCUGUUCCUUAUUU--  CU         --|  U    C   U     U  UGAAACA 
                     GC  CUUGUGUUA  AGG GCAU UAG GCAGU AG       G
                     CG  GGACACGGU  UCC CGUA AUC CGUCA UC       C
AAAAUUUUACGACAUAUAAUC  UC         CU^  C    A   C     -  UAAGAUU 
   120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Dno-Mir-17-P2b_5p

MirBase accessionMIMAT0047513
Sequence
0- UAAGGUGCAUCUAGUGCAGUUAG -23
Get sequence
Star sequence

Dno-Mir-17-P2b_3p* (predicted)

MirBase accessionMIMAT0047514
Sequence
39- CUACUGCCCUAAAUGCCCCUUCUGGC -65
Get sequence