MirGeneDB

MirGeneDB ID

Dno-Mir-17-P1b

Family name MIR-17 (all species)
Seed AAAGUGC
Species Nine-banded armadillo (Dasypus novemcinctus)
MiRBase ID dno-mir-106a
Paralogues Dno-Mir-17-P1a  Dno-Mir-17-P1c  Dno-Mir-17-P2a  Dno-Mir-17-P2b  Dno-Mir-17-P3a  Dno-Mir-17-P3b  Dno-Mir-17-P3c 
Orthologues Aca-Mir-17-P1b  Bta-Mir-17-P1b  Cfa-Mir-17-P1b  Cli-Mir-17-P1b  Cpi-Mir-17-P1b  Cpo-Mir-17-P1b  Ete-Mir-17-P1b  Gga-Mir-17-P1b  Hsa-Mir-17-P1b  Mdo-Mir-17-P1b  Mml-Mir-17-P1b  Mmu-Mir-17-P1b  Oan-Mir-17-P1b  Ocu-Mir-17-P1b  Rno-Mir-17-P1b  Sha-Mir-17-P1b  Tgu-Mir-17-P1b  Xtr-Mir-17-P1b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(dasNov3)
JH573198: 1052307-1052364 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-17-P1b)
Mir-17-P1b JH573198: 1052307-1052364 [+] UCSC Ensembl
Mir-17-P2b JH573198: 1052463-1052527 [+] UCSC Ensembl
Mir-17-P3b JH573198: 1052698-1052758 [+] UCSC Ensembl
Mir-19-P2b JH573198: 1052822-1052884 [+] UCSC Ensembl
Mir-92-P1b JH573198: 1052961-1053022 [+] UCSC Ensembl
Mir-92-P2b JH573198: 1053115-1053179 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUUUGCUACAGGAAUAGGCCUUGGCCGUGUAAAAGUGCUUGCAGUGCAGGUAGUUUUUGAGAUCUACUGCAAUGCAAGCACUUCUUACAUUACCAUGGUGAUUUAAUCAAUGGCUACU
Get precursor sequence
Structure
        10          20        30         40        50        
UUUUGCUACAGGAAUAG--   U   CC      -|          G     G   UUUU 
                   GCC UGG  GUGUAA AAGUGCUUGCA UGCAG UAG    U
                   UGG ACC  UACAUU UUCACGAACGU ACGUC AUC    G
UCAUCGGUAACUAAUUUAG   U   AU      C^          A     -   UAGA 
      110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsNo
Tissue expression
 +
To
Mature sequence

Dno-Mir-17-P1b_5p

MirBase accessionMIMAT0047604
Sequence
0- AAAAGUGCUUGCAGUGCAGGUAG -23
Get sequence
Star sequence

Dno-Mir-17-P1b_3p* (predicted)

MirBase accessionMIMAT0047605
Sequence
35- ACUGCAAUGCAAGCACUUCUUAC -58
Get sequence