MirGeneDB

MirGeneDB ID

Dno-Mir-140-v1

Family name MIR-140 (all species)
Seed CCACAGG
Species Nine-banded armadillo (Dasypus novemcinctus)
MiRBase ID dno-mir-140
Paralogues Dno-Mir-140-v2 
Orthologues Aca-Mir-140-v1  Ami-Mir-140-v1  Bta-Mir-140-v1  Cfa-Mir-140-v1  Cli-Mir-140-v1  Cpi-Mir-140-v1  Cpo-Mir-140-v1  Dre-Mir-140-v1  Ete-Mir-140-v1  Gga-Mir-140-v1  Hsa-Mir-140-v1  Mdo-Mir-140-v1  Mml-Mir-140-v1  Mmu-Mir-140-v1  Oan-Mir-140-v1  Ocu-Mir-140-v1  Rno-Mir-140-v1  Sha-Mir-140-v1  Sto-Mir-140-v1  Tgu-Mir-140-v1  Xtr-Mir-140-v1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(dasNov3)
JH569970: 120638-120699 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-140-v1)
Mir-140-v1 JH569970: 120638-120699 [-] UCSC Ensembl
Mir-140-v2 JH569970: 120638-120699 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCUGUGUGUGUGUGUCUCUCUGUGUCCUGCCAGUGGUUUUACCCUAUGGUAGGUUACGUCAUGCUGUUCUACCACAGGGUAGAACCACGGACAGGAUACCGGGGCAGCCUCUGCAUCGAAGG
Get precursor sequence
Structure
        10          20         30        40        50        60
UCUGUGUGUGUGUGUCU--   U        -| A             A      GUUACGU 
                   CUC GUGUCCUG CC GUGGUUUUACCCU UGGUAG       C
                   GGG CAUAGGAC GG CACCAAGAUGGGA ACCAUC       A
GGAAGCUACGUCUCCGACG   C        A^ -             C      UUGUCGU 
120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Dno-Mir-140-v1_5p*

MirBase accessionMIMAT0047653
Sequence
0- CAGUGGUUUUACCCUAUGGUAG -22
Get sequence
Mature sequence

Dno-Mir-140-v1_3p

MirBase accessionMIMAT0047654
Sequence
40- ACCACAGGGUAGAACCACGGAC -62
Get sequence