MirGeneDB

MirGeneDB ID

Dmo-Mir-968

Family name MIR-968 (all species)
Seed AAGUAGU
Species Fruit fly (Drosophila mojavensis)
MiRBase ID
Paralogues
Orthologues Dan-Mir-968  Dme-Mir-968 
Node of Origin (locus) Drosophila
Node of Origin (family) Drosophila
Genome context
(Dmoj_caf1)
scaffold_6500: 16664517-16664575 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UUAAAAUUUGUGAAAAUUAUGCAAGUAUCAUAAGUAGUAACCAUUAAAAGGUCGUGAUUUGAACUCAACCUUUUAAUUUACUACUUGUGAUAAAUGCAUAGAAAUGUCAACAACAACAA
Get precursor sequence
Structure
        10          20        30        40        50          
UUAAAAUUUGUGAAAAU--|     AG               CC          CGUGAUU 
                   UAUGCA  UAUCAUAAGUAGUAA  AUUAAAAGGU       \
                   AUACGU  AUAGUGUUCAUCAUU  UAAUUUUCCA       U
AACAACAACAACUGUAAAG^     AA               --          ACUCAAG 
       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Em Fe Ma Ma
Mature sequence

Dmo-Mir-968_5p

MirBase accessionNone
Sequence
0- UAAGUAGUAACCAUUAAAAGGUCG -24
Get sequence
Star sequence

Dmo-Mir-968_3p*

MirBase accessionNone
Sequence
37- ACCUUUUAAUUUACUACUUGUG -59
Get sequence