MirGeneDB

MirGeneDB ID

Dmo-Mir-963

Family name MIR-963 (all species)
Seed CAAGGUA
Species Fruit fly (Drosophila mojavensis)
MiRBase ID
Paralogues
Orthologues Dan-Mir-963  Dme-Mir-963 
Node of Origin (locus) Drosophila
Node of Origin (family) Drosophila
Genome context
(Dmoj_caf1)
scaffold_6500: 14019392-14019454 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GGAGUGCGCACUGAAUCGGUCUAAUCUAAAACAAGGUACAUAUCAGAGUGUUUCCCGUAUUCGAGUUUUGAAACCUCUGUAUAUACCUUUCAUUAGAUUCAACCGAAAGUCCAUAAAUAUUGA
Get precursor sequence
Structure
        10          20        30        40        50        60  
GGAGUGCGCACUGAAUC--|  CU       AAC      C   U     U     CCGUAUU 
                   GGU  AAUCUAA   AAGGUA AUA CAGAG GUUUC       \
                   CCA  UUAGAUU   UUCCAU UAU GUCUC CAAAG       C
AGUUAUAAAUACCUGAAAG^  AC       ACU      A   -     -     UUUUGAG 
 120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsNo
Tissue expression
 +
Em Fe Ma Ma
Mature sequence

Dmo-Mir-963_5p

MirBase accessionNone
Sequence
0- ACAAGGUACAUAUCAGAGUGUUUC -24
Get sequence
Star sequence

Dmo-Mir-963_3p*

MirBase accessionNone
Sequence
41- AACCUCUGUAUAUACCUUUCAU -63
Get sequence