MirGeneDB

MirGeneDB ID

Dmo-Mir-9-P8

Family name MIR-9 (all species)
Seed CUUUGGU
Species Fruit fly (Drosophila mojavensis)
MiRBase ID dmo-mir-9b
Paralogues Dmo-Mir-9-P7  Dmo-Mir-9-P9  Dmo-Mir-9-P10-v1  Dmo-Mir-9-P10-v2  Dmo-Mir-9-P11 
Orthologues Aae-Mir-9-P8  Cin-Mir-9  Cte-Mir-9  Dan-Mir-9-P8  Dme-Mir-9-P8  Hme-Mir-9-o8  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Pmi-Mir-9  Spu-Mir-9 
Node of Origin (locus) Diptera
Node of Origin (family) Bilateria
Genome context
(Dmoj_caf1)
scaffold_6500: 7202321-7202381 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-9-P8)
Mir-9-P9 scaffold_6500: 7201357-7201423 [+] Ensembl
Mir-306 scaffold_6500: 7201959-7202025 [+] Ensembl
Mir-9-P10-v1 scaffold_6500: 7202147-7202208 [+] Ensembl
Mir-9-P10-v2 scaffold_6500: 7202147-7202208 [+] Ensembl
Mir-9-P8 scaffold_6500: 7202321-7202381 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GUUUGGCUUUUUAUUUUGCAUAUUAUUUGUUCUUUGGUGAUUUUAGCUGUAUGGUGUGCGCGUAUUCCAUAGAGCUUUAUUACCAAAAACCAAAUGGUCUUUGCAUUGCUUUCUUUUCGUU
Get precursor sequence
Structure
        10        20          30        40        50        60
GUUUGGCUUUUUAUUUUGCAU--|       UUC         UUU    G    GUGUGC 
                       AUUAUUUG   UUUGGUGAU   AGCU UAUG      G
                       UGGUAAAC   AAACCAUUA   UCGA AUAC      C
UUGCUUUUCUUUCGUUACGUUUC^       CAA         UU-    G    CUUAUG 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), UGUG in loop
Tissue expression
 +
Em Fe Ma Ma
Mature sequence

Dmo-Mir-9-P8_5p

MirBase accessionMIMAT0008666
Sequence
0- UCUUUGGUGAUUUUAGCUGUAUG -23
Get sequence
Star sequence

Dmo-Mir-9-P8_3p*

MirBase accessionNone
Sequence
39- UAGAGCUUUAUUACCAAAAACC -61
Get sequence