MirGeneDB

MirGeneDB ID

Dmo-Mir-9-P10-v2

Family name MIR-9 (all species)
Seed UAAAGCU
Species Fruit fly (Drosophila mojavensis)
MiRBase ID dmo-mir-79
Paralogues Dmo-Mir-9-P7  Dmo-Mir-9-P8  Dmo-Mir-9-P9  Dmo-Mir-9-P10-v1  Dmo-Mir-9-P11 
Orthologues Aae-Mir-9-P10-v1  Aae-Mir-9-P10-v2  Cin-Mir-9  Cte-Mir-9  Dan-Mir-9-P10-v1  Dan-Mir-9-P10-v2  Dme-Mir-9-P10-v1  Dme-Mir-9-P10-v2  Hme-Mir-9-o10  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Pmi-Mir-9  Spu-Mir-9 
Node of Origin (locus) Diptera
Node of Origin (family) Bilateria
Genome context
(Dmoj_caf1)
scaffold_6500: 7202147-7202208 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-9-P10-v2)
Mir-9-P9 scaffold_6500: 7201357-7201423 [+] Ensembl
Mir-306 scaffold_6500: 7201959-7202025 [+] Ensembl
Mir-9-P10-v1 scaffold_6500: 7202147-7202208 [+] Ensembl
Mir-9-P10-v2 scaffold_6500: 7202147-7202208 [+] Ensembl
Mir-9-P8 scaffold_6500: 7202321-7202381 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GUGUUUUUAAAUAUUCGCCCCAUUGCCGUUGCUUUGGCGCUUUAGCUGUAUGAUAGAUUUAAAUACUUCAUAAAGCUAGAUUACCAAAGCAUUGGCUCUGUGGCCAAACCCCAGCGAACUUG
Get precursor sequence
Structure
        10         20         30        40        50        60
GUGUUUUUAAAUAUUCGC-  -| UU    U        CGC       G     UAGAUU 
                   CC CA  GCCG UGCUUUGG   UUUAGCU UAUGA      U
                   GG GU  CGGU ACGAAACC   AGAUCGA AUACU      A
GUUCAAGCGACCCCAAACC  U^ CU    U        AUU       A     UCAUAA 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Em Fe Ma Ma
Star sequence

Dmo-Mir-9-P10-v2_5p*

MirBase accessionNone
Sequence
0- GCUUUGGCGCUUUAGCUGUAUGA -23
Get sequence
Mature sequence

Dmo-Mir-9-P10-v2_3p

MirBase accessionMIMAT0008690
Sequence
39- AUAAAGCUAGAUUACCAAAGCAU -62
Get sequence