MirGeneDB

MirGeneDB ID

Dmo-Mir-2-P1b-v1

Family name MIR-2 (all species)
Seed AUCACAG
Species Fruit fly (Drosophila mojavensis)
MiRBase ID dmo-mir-2a-2
Paralogues Dmo-Mir-2-P1a-v1  Dmo-Mir-2-P1a-v2  Dmo-Mir-2-P1b-v2  Dmo-Mir-2-P2b  Dmo-Mir-2-P3  Dmo-Mir-2-P4a  Dmo-Mir-2-P4b1  Dmo-Mir-2-P4b2  Dmo-Mir-2-P5  Dmo-Mir-2-P6a  Dmo-Mir-2-P6b  Dmo-Mir-2-P6c  Dmo-Mir-2-P7  Dmo-Mir-2-P8  Dmo-Mir-2-P9 
Orthologues Dan-Mir-2-P1b-v1  Dan-Mir-2-P1b-v2  Dme-Mir-2-P1b-v1  Dme-Mir-2-P1b-v2  Dpu-Mir-2-o1 
Node of Origin (locus) Drosophila
Node of Origin (family) Protostomia
Genome context
(Dmoj_caf1)
scaffold_6500: 6908918-6908977 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-2-P1b-v1)
Mir-2-P2b scaffold_6500: 6907827-6907894 [+] Ensembl
Mir-2-P1a-v1 scaffold_6500: 6908329-6908396 [+] Ensembl
Mir-2-P1a-v2 scaffold_6500: 6908329-6908396 [+] Ensembl
Mir-2-P1b-v2 scaffold_6500: 6908917-6908978 [+] Ensembl
Mir-2-P1b-v1 scaffold_6500: 6908918-6908977 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UCAAAAGAAAUUUGAUGUUGCUUAUCUAAGCCUCAUCAAGUGGUUGUGAUAUGGAUACCCGACGCAUAUCACAGCCAGCUUUGAUGAGCUAGGAUAAUCAACGGAAAACAACAAGAGAAA
Get precursor sequence
Structure
        10          20        30        40          50         
UCAAAAGAAAUUUGAUG--   C      A  C         --|            GAUAC 
                   UUG UUAUCU AG CUCAUCAAG  UGGUUGUGAUAUG     \
                   AAC AAUAGG UC GAGUAGUUU  ACCGACACUAUAC     C
AAAGAGAACAACAAAAGGC   U      A  -         CG^            GCAGC 
.       110       100        90         80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Em Fe Ma Ma
Star sequence

Dmo-Mir-2-P1b-v1_5p*

MirBase accessionNone
Sequence
0- CCUCAUCAAGUGGUUGUGAUAUG -23
Get sequence
Mature sequence

Dmo-Mir-2-P1b-v1_3p

MirBase accessionMIMAT0008672
Sequence
36- UAUCACAGCCAGCUUUGAUGAGCU -60
Get sequence