
MirGeneDB ID


Family name MIR-2 (all species)
Species Fruit fly (Drosophila mojavensis)
MiRBase ID dmo-mir-2a-1
Paralogues Dmo-Mir-2-P1a-v2  Dmo-Mir-2-P1b-v1  Dmo-Mir-2-P1b-v2  Dmo-Mir-2-P2b  Dmo-Mir-2-P3  Dmo-Mir-2-P4a  Dmo-Mir-2-P4b1  Dmo-Mir-2-P4b2  Dmo-Mir-2-P5  Dmo-Mir-2-P6a  Dmo-Mir-2-P6b  Dmo-Mir-2-P6c  Dmo-Mir-2-P7  Dmo-Mir-2-P8  Dmo-Mir-2-P9 
Orthologues Dan-Mir-2-P1a-v1  Dan-Mir-2-P1a-v2  Dme-Mir-2-P1a-v1  Dme-Mir-2-P1a-v2  Dpu-Mir-2-o1 
Node of Origin (locus) Drosophila
Node of Origin (family) Protostomia
Genome context
scaffold_6500: 6908329-6908396 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-2-P1a-v1)
Mir-2-P2b scaffold_6500: 6907827-6907894 [+] Ensembl
Mir-2-P1a-v1 scaffold_6500: 6908329-6908396 [+] Ensembl
Mir-2-P1a-v2 scaffold_6500: 6908329-6908396 [+] Ensembl
Mir-2-P1b-v2 scaffold_6500: 6908917-6908978 [+] Ensembl
Mir-2-P1b-v1 scaffold_6500: 6908918-6908977 [+] Ensembl
(pre-Mir +30nt flank)
Get precursor sequence
        10           20        30         40         50        60  
AUCAUAAGAAUUGGCCA---    C           -      A-|       A   CAUUUUGAA 
                    CAUU AUGCUGAGCUC UCAAAG  GGCUGUGA AUG         A
                    GUAA UGCGAUUCGAG AGUUUC  CCGACACU UAC         G
ACUAACUAACUACAUGCAAU    -           U      GA^       A   GAGCGUUUC 
      120       110        100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
Em Fe Ma Ma
Star sequence


MirBase accessionNone
Get sequence
Mature sequence


MirBase accessionMIMAT0008672
Get sequence