MirGeneDB

MirGeneDB ID

Dme-Mir-963

Family name MIR-963 (all species)
Seed CAAGGUA
Species Fruit fly (Drosophila melanogaster)
MiRBase ID dme-mir-963
Paralogues
Orthologues Dan-Mir-963  Dmo-Mir-963 
Node of Origin (locus) Drosophila
Node of Origin (family) Drosophila
Genome context
(dm6)
chr2L: 5642005-5642064 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-963)
Mir-959-v1 chr2L: 5640958-5641021 [+] UCSC Ensembl
Mir-959-v2 chr2L: 5640959-5641020 [+] UCSC Ensembl
Mir-960 chr2L: 5641081-5641140 [+] UCSC Ensembl
Mir-961 chr2L: 5641208-5641266 [+] UCSC Ensembl
Mir-962 chr2L: 5641315-5641374 [+] UCSC Ensembl
Mir-963 chr2L: 5642005-5642064 [+] UCSC Ensembl
Mir-964-v1 chr2L: 5642127-5642187 [+] UCSC Ensembl
Mir-964-v2 chr2L: 5642128-5642186 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UACAACUAAUUUUUCUUAGUCUAAUCUAAAACAAGGUAAAUAUCAGGUUGUUUCCUGUAUUCGAUCGAAACAUCUGUAUAUACCUUUGUUCCGAUUGGACAAAAGUGCGUCUUCUAGUUG
Get precursor sequence
Structure
        10          20        30         40        50        60
UACAACUAAUUUUUCUUA--|       UAA     -    A   U     U     CUGUA 
                    GUCUAAUC   AACAA GGUA AUA CAGGU GUUUC     U
                    CAGGUUAG   UUGUU CCAU UAU GUCUA CAAAG     U
GUUGAUCUUCUGCGUGAAAA^       CC-     U    A   -     -     CUAGC 
.       110       100         90        80          70
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer site -1 relative to what is annotated here.
3' NTU Yes
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo He L3 Fe Fe La Wh
Mature sequence

Dme-Mir-963_5p

MirBase accessionMIMAT0005477
Sequence
0- ACAAGGUAAAUAUCAGGUUGUUUC -24
Get sequence
Validated targets microrna.org: MIMAT0005477
TargetScanFly: dme-miR-963
Star sequence

Dme-Mir-963_3p*

MirBase accessionMIMAT0020858
Sequence
38- AACAUCUGUAUAUACCUUUGUU -60
Get sequence